Open Science Research Excellence

Open Science Index

Commenced in January 2007 Frequency: Monthly Edition: International Paper Count: 10

10
10009944
Using TRACE, PARCS, and SNAP Codes to Analyze the Load Rejection Transient of ABWR
Abstract:

The purpose of the study is to analyze the load rejection transient of ABWR by using TRACE, PARCS, and SNAP codes. This study has some steps. First, using TRACE, PARCS, and SNAP codes establish the model of ABWR. Second, the key parameters are identified to refine the TRACE/PARCS/SNAP model further in the frame of a steady state analysis. Third, the TRACE/PARCS/SNAP model is used to perform the load rejection transient analysis. Finally, the FSAR data are used to compare with the analysis results. The results of TRACE/PARCS are consistent with the FSAR data for the important parameters. It indicates that the TRACE/PARCS/SNAP model of ABWR has a good accuracy in the load rejection transient.

Keywords:
9
10009768
The Main Steamline Break Transient Analysis for Advanced Boiling Water Reactor Using TRACE, PARCS, and SNAP Codes
Abstract:

To confirm the reactor and containment integrity of the Advanced Boiling Water Reactor (ABWR), we perform the analysis of main steamline break (MSLB) transient by using the TRACE, PARCS, and SNAP codes. The process of the research has four steps. First, the ABWR nuclear power plant (NPP) model is developed by using the above codes. Second, the steady state analysis is performed by using this model. Third, the ABWR model is used to run the analysis of MSLB transient. Fourth, the predictions of TRACE and PARCS are compared with the data of FSAR. The results of TRACE/PARCS and FSAR are similar. According to the TRACE/PARCS results, the reactor and containment integrity of ABWR can be maintained in a safe condition for MSLB.

Keywords:
8
10007688
Using SNAP and RADTRAD to Establish the Analysis Model for Maanshan PWR Plant
Abstract:
In this study, we focus on the establishment of the analysis model for Maanshan PWR nuclear power plant (NPP) by using RADTRAD and SNAP codes with the FSAR, manuals, and other data. In order to evaluate the cumulative dose at the Exclusion Area Boundary (EAB) and Low Population Zone (LPZ) outer boundary, Maanshan NPP RADTRAD/SNAP model was used to perform the analysis of the DBA LOCA case. The analysis results of RADTRAD were similar to FSAR data. These analysis results were lower than the failure criteria of 10 CFR 100.11 (a total radiation dose to the whole body, 250 mSv; a total radiation dose to the thyroid from iodine exposure, 3000 mSv).
7
10006773
The Mitigation Strategy Analysis of Kuosheng Nuclear Power Plant Spent Fuel Pool Using MELCOR2.1/SNAP
Abstract:

Kuosheng nuclear power plant (NPP) is a BWR/6 plant in Taiwan. There is more concern for the safety of Spent Fuel Pools (SFPs) in Taiwan after Fukushima event. In order to estimate the safety of Kuosheng NPP SFP, by using MELCOR2.1 and SNAP, the safety analysis of Kuosheng NPP SFP was performed combined with the mitigation strategy of NEI 06-12 report. There were several steps in this research. First, the Kuosheng NPP SFP models were established by MELCOR2.1/SNAP. Second, the Station Blackout (SBO) analysis of Kuosheng SFP was done by TRACE and MELCOR under the cooling system failure condition. The results showed that the calculations of MELCOR and TRACE were very similar in this case. Second, the mitigation strategy analysis was done with the MELCOR model by following the NEI 06-12 report. The results showed the effectiveness of NEI 06-12 strategy in Kuosheng NPP SFP. Finally, a sensitivity study of SFP quenching was done to check the differences of different water injection time and the phenomena during the quenching. The results showed that if the cladding temperature was over 1600 K, the water injection may have chance to cause the accident more severe with more hydrogen generation. It was because of the oxidation heat and the “Breakaway” effect of the zirconium-water reaction. An animation model built by SNAP was also shown in this study.

6
10005875
The Establishment of RELAP5/SNAP Model for Kuosheng Nuclear Power Plant
Abstract:

After the measurement uncertainty recapture (MUR) power uprates, Kuosheng nuclear power plant (NPP) was uprated the power from 2894 MWt to 2943 MWt. For power upgrade, several codes (e.g., TRACE, RELAP5, etc.) were applied to assess the safety of Kuosheng NPP. Hence, the main work of this research is to establish a RELAP5/MOD3.3 model of Kuosheng NPP with SNAP interface. The establishment of RELAP5/SNAP model was referred to the FSAR, training documents, and TRACE model which has been developed and verified before. After completing the model establishment, the startup test scenarios would be applied to the RELAP5/SNAP model. With comparing the startup test data and TRACE analysis results, the applicability of RELAP5/SNAP model would be assessed.

Keywords:
5
10005564
The Model Establishment and Analysis of TRACE/MELCOR for Kuosheng Nuclear Power Plant Spent Fuel Pool
Abstract:

Kuosheng nuclear power plant (NPP) is a BWR/6 plant in Taiwan. There is more concern for the safety of NPPs in Taiwan after Japan Fukushima NPP disaster occurred. Hence, in order to estimate the safety of Kuosheng NPP spent fuel pool (SFP), by using TRACE, MELCOR, and SNAP codes, the safety analysis of Kuosheng NPP SFP was performed. There were two main steps in this research. First, the Kuosheng NPP SFP models were established. Second, the transient analysis of Kuosheng SFP was done by TRACE and MELCOR under the cooling system failure condition (Fukushima-like condition). The results showed that the calculations of MELCOR and TRACE were very similar in this case, and the fuel uncover happened roughly at 4th day after the failure of cooling system. The above results indicated that Kuosheng NPP SFP may be unsafe in the case of long-term SBO situation. In addition, future calculations were needed to be done by the other codes like FRAPTRAN for the cladding calculations.

4
10004585
The Model Establishment and Analysis of TRACE/FRAPTRAN for Chinshan Nuclear Power Plant Spent Fuel Pool
Abstract:
TRACE is developed by U.S. NRC for the nuclear power plants (NPPs) safety analysis. We focus on the establishment and application of TRACE/FRAPTRAN/SNAP models for Chinshan NPP (BWR/4) spent fuel pool in this research. The geometry is 12.17 m × 7.87 m × 11.61 m for the spent fuel pool. In this study, there are three TRACE/SNAP models: one-channel, two-channel, and multi-channel TRACE/SNAP model. Additionally, the cooling system failure of the spent fuel pool was simulated and analyzed by using the above models. According to the analysis results, the peak cladding temperature response was more accurate in the multi-channel TRACE/SNAP model. The results depicted that the uncovered of the fuels occurred at 2.7 day after the cooling system failed. In order to estimate the detailed fuel rods performance, FRAPTRAN code was used in this research. According to the results of FRAPTRAN, the highest cladding temperature located on the node 21 of the fuel rod (the highest node at node 23) and the cladding burst roughly after 3.7 day.
3
9998636
Ensuring Consistency under the Snapshot Isolation
Abstract:

By running transactions under the SNAPSHOT isolation we can achieve a good level of concurrency, specially in databases with high-intensive read workloads. However, SNAPSHOT is not immune to all the problems that arise from competing transactions and therefore no serialization warranty exists. We propose in this paper a technique to obtain data consistency with SNAPSHOT by using some special triggers that we named DAEMON TRIGGERS. Besides keeping the benefits of the SNAPSHOT isolation, the technique is specially useful for those database systems that do not have an isolation level that ensures serializability, like Firebird and Oracle. We describe all the anomalies that might arise when using the SNAPSHOT isolation and show how to preclude them with DAEMON TRIGGERS. Based on the methodology presented here, it is also proposed the creation of a new isolation level: DAEMON SNAPSHOT.

2
9998938
Genetic Polymorphisms and Haplotype Structure of the Organic Cation Transporter 1 Gene in the Zulu Population of South Africa
Abstract:

Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.

1
9999156
Turbine Trip without Bypass Analysis of Kuosheng Nuclear Power Plant Using TRACE Coupling with FRAPTRAN
Abstract:

This analysis of Kuosheng nuclear power plant (NPP) was performed mainly by TRACE, assisted with FRAPTRAN and FRAPCON. SNAP v2.2.1 and TRACE v5.0p3 are used to develop the Kuosheng NPP SPU TRACE model which can simulate the turbine trip without bypass transient. From the analysis of TRACE, the important parameters such as dome pressure, coolant temperature and pressure can be determined. Through these parameters, comparing with the criteria which were formulated by United States Nuclear Regulatory Commission (U.S. NRC), we can determine whether the Kuoshengnuclear power plant failed or not in the accident analysis. However, from the data of TRACE, the fuel rods status cannot be determined. With the information from TRACE and burn-up analysis obtained from FRAPCON, FRAPTRAN analyzes more details about the fuel rods in this transient. Besides, through the SNAP interface, the data results can be presented as an animation. From the animation, the TRACE and FRAPTRAN data can be merged together that may be realized by the readers more easily. In this research, TRACE showed that the maximum dome pressure of the reactor reaches to 8.32 MPa, which is lower than the acceptance limit 9.58 MPa. Furthermore, FRAPTRAN revels that the maximum strain is about 0.00165, which is below the criteria 0.01. In addition, cladding enthalpy is 52.44 cal/g which is lower than 170 cal/g specified by the USNRC NUREG-0800 Standard Review Plan.

Vol:13 No:03 2019Vol:13 No:02 2019Vol:13 No:01 2019
Vol:12 No:12 2018Vol:12 No:11 2018Vol:12 No:10 2018Vol:12 No:09 2018Vol:12 No:08 2018Vol:12 No:07 2018Vol:12 No:06 2018Vol:12 No:05 2018Vol:12 No:04 2018Vol:12 No:03 2018Vol:12 No:02 2018Vol:12 No:01 2018
Vol:11 No:12 2017Vol:11 No:11 2017Vol:11 No:10 2017Vol:11 No:09 2017Vol:11 No:08 2017Vol:11 No:07 2017Vol:11 No:06 2017Vol:11 No:05 2017Vol:11 No:04 2017Vol:11 No:03 2017Vol:11 No:02 2017Vol:11 No:01 2017
Vol:10 No:12 2016Vol:10 No:11 2016Vol:10 No:10 2016Vol:10 No:09 2016Vol:10 No:08 2016Vol:10 No:07 2016Vol:10 No:06 2016Vol:10 No:05 2016Vol:10 No:04 2016Vol:10 No:03 2016Vol:10 No:02 2016Vol:10 No:01 2016
Vol:9 No:12 2015Vol:9 No:11 2015Vol:9 No:10 2015Vol:9 No:09 2015Vol:9 No:08 2015Vol:9 No:07 2015Vol:9 No:06 2015Vol:9 No:05 2015Vol:9 No:04 2015Vol:9 No:03 2015Vol:9 No:02 2015Vol:9 No:01 2015
Vol:8 No:12 2014Vol:8 No:11 2014Vol:8 No:10 2014Vol:8 No:09 2014Vol:8 No:08 2014Vol:8 No:07 2014Vol:8 No:06 2014Vol:8 No:05 2014Vol:8 No:04 2014Vol:8 No:03 2014Vol:8 No:02 2014Vol:8 No:01 2014
Vol:7 No:12 2013Vol:7 No:11 2013Vol:7 No:10 2013Vol:7 No:09 2013Vol:7 No:08 2013Vol:7 No:07 2013Vol:7 No:06 2013Vol:7 No:05 2013Vol:7 No:04 2013Vol:7 No:03 2013Vol:7 No:02 2013Vol:7 No:01 2013
Vol:6 No:12 2012Vol:6 No:11 2012Vol:6 No:10 2012Vol:6 No:09 2012Vol:6 No:08 2012Vol:6 No:07 2012Vol:6 No:06 2012Vol:6 No:05 2012Vol:6 No:04 2012Vol:6 No:03 2012Vol:6 No:02 2012Vol:6 No:01 2012
Vol:5 No:12 2011Vol:5 No:11 2011Vol:5 No:10 2011Vol:5 No:09 2011Vol:5 No:08 2011Vol:5 No:07 2011Vol:5 No:06 2011Vol:5 No:05 2011Vol:5 No:04 2011Vol:5 No:03 2011Vol:5 No:02 2011Vol:5 No:01 2011
Vol:4 No:12 2010Vol:4 No:11 2010Vol:4 No:10 2010Vol:4 No:09 2010Vol:4 No:08 2010Vol:4 No:07 2010Vol:4 No:06 2010Vol:4 No:05 2010Vol:4 No:04 2010Vol:4 No:03 2010Vol:4 No:02 2010Vol:4 No:01 2010
Vol:3 No:12 2009Vol:3 No:11 2009Vol:3 No:10 2009Vol:3 No:09 2009Vol:3 No:08 2009Vol:3 No:07 2009Vol:3 No:06 2009Vol:3 No:05 2009Vol:3 No:04 2009Vol:3 No:03 2009Vol:3 No:02 2009Vol:3 No:01 2009
Vol:2 No:12 2008Vol:2 No:11 2008Vol:2 No:10 2008Vol:2 No:09 2008Vol:2 No:08 2008Vol:2 No:07 2008Vol:2 No:06 2008Vol:2 No:05 2008Vol:2 No:04 2008Vol:2 No:03 2008Vol:2 No:02 2008Vol:2 No:01 2008
Vol:1 No:12 2007Vol:1 No:11 2007Vol:1 No:10 2007Vol:1 No:09 2007Vol:1 No:08 2007Vol:1 No:07 2007Vol:1 No:06 2007Vol:1 No:05 2007Vol:1 No:04 2007Vol:1 No:03 2007Vol:1 No:02 2007Vol:1 No:01 2007