Excellence in Research and Innovation for Humanity

International Science Index

Commenced in January 1999 Frequency: Monthly Edition: International Paper Count: 300

300
10003642
Elitist Self-Adaptive Step-Size Search in Optimum Sizing of Steel Structures
Abstract:
This paper covers application of an elitist selfadaptive step-size search (ESASS) to optimum design of steel skeletal structures. In the ESASS two approaches are considered for improving the convergence accuracy as well as the computational efficiency of the original technique namely the so called selfadaptive step-size search (SASS). Firstly, an additional randomness is incorporated into the sampling step of the technique to preserve exploration capability of the algorithm during the optimization. Moreover, an adaptive sampling scheme is introduced to improve the quality of final solutions. Secondly, computational efficiency of the technique is accelerated via avoiding unnecessary analyses during the optimization process using an upper bound strategy. The numerical results demonstrate the usefulness of the ESASS in the sizing optimization problems of steel truss and frame structures.
299
10003741
Comparative Study of IC and Perturb and Observe Method of MPPT Algorithm for Grid Connected PV Module
Abstract:
The purpose of this paper is to study and compare two maximum power point tracking (MPPT) algorithms in a photovoltaic simulation system and also show a simulation study of maximum power point tracking (MPPT) for photovoltaic systems using perturb and observe algorithm and Incremental conductance algorithm. Maximum power point tracking (MPPT) plays an important role in photovoltaic systems because it maximize the power output from a PV system for a given set of conditions, and therefore maximize the array efficiency and minimize the overall system cost. Since the maximum power point (MPP) varies, based on the irradiation and cell temperature, appropriate algorithms must be utilized to track the (MPP) and maintain the operation of the system in it. MATLAB/Simulink is used to establish a model of photovoltaic system with (MPPT) function. This system is developed by combining the models established of solar PV module and DC-DC Boost converter. The system is simulated under different climate conditions. Simulation results show that the photovoltaic simulation system can track the maximum power point accurately.
298
10003641
Performance Comparison of Resource Allocation without Feedback in Wireless Body Area Networks by Various Pseudo Orthogonal Sequences
Abstract:
Wireless Body Area Network (WBAN) is a short-range wireless communication around human body for various applications such as wearable devices, entertainment, military, and especially medical devices. WBAN attracts the attention of continuous health monitoring system including diagnostic procedure, early detection of abnormal conditions, and prevention of emergency situations. Compared to cellular network, WBAN system is more difficult to control inter- and inner-cell interference due to the limited power, limited calculation capability, mobility of patient, and non-cooperation among WBANs. In this paper, we compare the performance of resource allocation scheme based on several Pseudo Orthogonal Codewords (POCs) to mitigate inter-WBAN interference. Previously, the POCs are widely exploited for a protocol sequence and optical orthogonal code. Each POCs have different properties of auto- and cross-correlation and spectral efficiency according to its construction of POCs. To identify different WBANs, several different pseudo orthogonal patterns based on POCs exploits for resource allocation of WBANs. By simulating these pseudo orthogonal resource allocations of WBANs on MATLAB, we obtain the performance of WBANs according to different POCs and can analyze and evaluate the suitability of POCs for the resource allocation in the WBANs system.
297
10003640
Power Quality Improvement Using UPQC Integrated with Distributed Generation Network
Abstract:
The increasing demand of electric power is giving an emphasis on the need for the maximum utilization of renewable energy sources. On the other hand maintaining power quality to satisfaction of utility is an essential requirement. In this paper the design aspects of a Unified Power Quality Conditioner integrated with photovoltaic system in a distributed generation is presented. The proposed system consist of series inverter, shunt inverter are connected back to back on the dc side and share a common dc-link capacitor with Distributed Generation through a boost converter. The primary task of UPQC is to minimize grid voltage and load current disturbances along with reactive and harmonic power compensation. In addition to primary tasks of UPQC, other functionalities such as compensation of voltage interruption and active power transfer to the load and grid in both islanding and interconnected mode have been addressed. The simulation model is design in MATLAB/ Simulation environment and the results are in good agreement with the published work.
296
10003639
GC and GCxGC-MS Composition of Volatile Compounds from Carum carvi by Using Techniques Assisted by Microwaves
Abstract:
The new methods as accelerated steam distillation assisted by microwave (ASDAM) is a combination of microwave heating and steam distillation, performed at atmospheric pressure at very short extraction time. Isolation and concentration of volatile compounds are performed by a single stage. (ASDAM) has been compared with (ASDAM) with cryogrinding of seeds (CG) and a conventional technique, hydrodistillation assisted by microwave (HDAM), hydro-distillation (HD) for the extraction of essential oil from aromatic herb as caraway and cumin seeds. The essential oils extracted by (ASDAM) for 1 min were quantitatively (yield) and qualitatively (aromatic profile) no similar to those obtained by ASDAM-CG (1 min) and HD (for 3 h). The accelerated microwave extraction with cryogrinding inhibits numerous enzymatic reactions as hydrolysis of oils. Microwave radiations constitute the adequate mean for the extraction operations from the yields and high content in major component majority point view, and allow to minimise considerably the energy consumption, but especially heating time too, which is one of essential parameters of artifacts formation. The ASDAM and ASDAM-CG are green techniques and yields an essential oil with higher amounts of more valuable oxygenated compounds comparable to the biosynthesis compounds, and allows substantial savings of costs, in terms of time, energy and plant material.
295
10003625
Neuron Dynamics of Single-Compartment Traub Model for Hardware Implementations
Abstract:
In this work we make a bifurcation analysis for a single compartment representation of Traub model, one of the most important conductance-based models. The analysis focus in two principal parameters: current and leakage conductance. Study of stable and unstable solutions are explored; also Hop-bifurcation and frequency interpretation when current varies is examined. This study allows having control of neuron dynamics and neuron response when these parameters change. Analysis like this is particularly important for several applications such as: tuning parameters in learning process, neuron excitability tests, measure bursting properties of the neuron, etc. Finally, a hardware implementation results were developed to corroborate these results.
294
10003624
Briquetting of Metal Chips by Controlled Impact: Experimental Study
Abstract:
For briquetting of metal chips are used hydraulic and mechanical presses. The density of the briquettes in this case is about 60% - 70 % on the density of solid metal. In this work are presented the results of experimental studies for briquetting of metal chips, by using a new technology for impact briquetting. The used chips are by Armco iron, steel, cast iron, copper, aluminum and brass. It has been found that: (i) in a controlled impact the density of the briquettes can be increases up to 30%; (ii) at the same specific impact energy Es (J/sm3) the density of the briquettes increases with increasing of the impact velocity; (iii), realization of the repeated impact leads to decrease of chips density, which can be explained by distribution of elastic waves in the briquette.
293
10003623
Evaluation of Robust Feature Descriptors for Texture Classification
Abstract:
Texture is an important characteristic in real and synthetic scenes. Texture analysis plays a critical role in inspecting surfaces and provides important techniques in a variety of applications. Although several descriptors have been presented to extract texture features, the development of object recognition is still a difficult task due to the complex aspects of texture. Recently, many robust and scaling-invariant image features such as SIFT, SURF and ORB have been successfully used in image retrieval and object recognition. In this paper, we have tried to compare the performance for texture classification using these feature descriptors with k-means clustering. Different classifiers including K-NN, Naive Bayes, Back Propagation Neural Network , Decision Tree and Kstar were applied in three texture image sets - UIUCTex, KTH-TIPS and Brodatz, respectively. Experimental results reveal SIFTS as the best average accuracy rate holder in UIUCTex, KTH-TIPS and SURF is advantaged in Brodatz texture set. BP neuro network works best in the test set classification among all used classifiers.
292
10003622
Implementation of MPPT Algorithm for Grid Connected PV Module with IC and P&O Method
Abstract:
In recent years, the use of renewable energy resources instead of pollutant fossil fuels and other forms has increased. Photovoltaic generation is becoming increasingly important as a renewable resource since it does not cause in fuel costs, pollution, maintenance, and emitting noise compared with other alternatives used in power applications. In this paper, Perturb and Observe and Incremental Conductance methods are used to improve energy conversion efficiency under different environmental conditions. PI controllers are used to control easily DC-link voltage, active and reactive currents. The whole system is simulated under standard climatic conditions (1000 W/m2, 250C) in MATLAB and the irradiance is varied from 1000 W/m2 to 300 W/m2. The use of PI controller makes it easy to directly control the power of the grid connected PV system. Finally the validity of the system will be verified through the simulations in MATLAB/Simulink environment.
291
10003621
Knowledge and Eating Behavior of Teenage Pregnancy
Abstract:
The purposed of this research was to study the eating habit of teenage pregnancy and its relationship to the knowledge of nutrition during pregnancy. The 100 samples were derived from simple random sampling technique of the teenage pregnancy in Bangkae District. The questionnaire was used to collect data with the reliability of 0.8. The data were analyzed by SPSS for Windows with multiple regression technique. Percentage, mean and the relationship of knowledge of eating and eating behavior were obtained. The research results revealed that their knowledge in nutrition was at the average of 4.07 and their eating habit that they mentioned most was to refrain from alcohol and caffeine at 82% and the knowledge in nutrition influenced their eating habits at 54% with the statistically significant level of 0.001.
290
10003620
Development of Lodging Business Management Standards of Bang Khonthi Community in Samut Songkram Province
Abstract:
This research aims to develop ways of lodging business management of Bang Khonthi community in Samut Songkram province that are appropriate with the cultural context of the Bang Khonthi community. Eight lodging business owners were interviewed. It was found that lodging business that are family business must be done with passion, correct understanding of self, culture, nature, Thai way of life, thorough, professional development, environmentally concerned, building partnerships with various networks both community level, and public sector and business cohorts. Public relations should be done through media both traditional and modern outlets, such as websites and social networks to provide customers convenience, security, happiness, knowledge, love and value when travel to Bang Khonthi. This will also help them achieve sustainability in business, in line with the 10 Home Stay Standard Thailand. Suggestions for operators are as follows: Operators need to improve their public relations work. They need to use technology in public relations such as the internet. Management standards must be improved. Souvenir and local products shops should be arranged in the compound. Product pricing must be set accordingly. They need to join hands to help each other. Quality of the business operation should be raised to meet the standards. Educational measures to reduce the impact caused by tourism on the community such as efforts to reduce energy consumption.
289
10003619
Isolation of Soil Thiobacterii and Determination of Their Bio-Oxidation Activity
Abstract:
36 strains of sulfur-oxidizing bacteria were isolated in Southern Kazakhstan soda-saline soils and identified. Screening of strains according bio-oxidation (destruction thiosulfate to sulfate) and enzymatic (Thiosulfate dehydrogenises and thiosulfate reductase) activity was conducted. There were selected modes of aeration and culture conditions (pH, temperature), which provide optimum harvest cells. These strains can be used in bio-melioration technology.
288
10003618
Cellolytic Activity of Bacteria of the Bacillus Genus Isolated from the Soil of Zailiskiy Alatau Slopes
Abstract:
This study was conducted for the investigation of number of cellulolytic bacteria and their ability in decomposition. Seven samples surface soil were collected on cellulose Zailiskii Alatau slopes. Cellulolitic activity of new strains of Bacillus, isolated from soil is determined. Isolated cellulose degrading bacteria were screened for determination of the highest cellulose activity by quantitative assay using Congo red, gravimetric assay and colorimetric DNS method trough of the determination of the parameters of sugar reduction. Strains are assigned to: B.subtilis, B.licheniformis, B. cereus and, В. megaterium. Bacillus strains consisting of several different types of cellulases have broad substrate specificity of cellulase complexes formed by them. Cellulolitic bacteria were recorded to have highest cellulase activity and selected for optimization of cellulase enzyme production.
287
10003588
Biodiversity of Plants Rhizosphere and Rhizoplane Bacteria in the Presence of Petroleum Hydrocarbons
Abstract:
Following plants-barley (Hordeum sativum), alfalfa (Medicago sativa), grass mixture (red fescue-75%, long-term ryegrass - 20% Kentucky bluegrass - 10%), oilseed rape (Brassica napus biennis), resistant to growth in the contaminated soil with oil content of 15.8 g / kg 25.9 g / kg soil were used. Analysis of the population showed that the oil pollution reduces the number of bacteria in the rhizosphere and rhizoplane of plants and enhances the amount of spore-forming bacteria and saprotrophic micromycetes. It was shown that regardless of the plant, dominance of Pseudomonas and Bacillus genera bacteria was typical for the rhizosphere and rhizoplane of plants. The frequency of bacteria of these genera was more than 60%. Oil pollution changes the ratio of occurrence of various types of bacteria in the rhizosphere and rhizoplane of plants. Besides the Pseudomonas and Bacillus genera, in the presence of hydrocarbons in the root zone of plants dominant and most typical were the representatives of the Mycobacterium and Rhodococcus genera. Together the number was between 62% to 72%.
286
10003560
Transformations of Spatial Distributions of Bio-Polymers and Nanoparticles in Water Suspensions Induced by Resonance-Like Low Frequency Electrical Fields
Abstract:
Water suspensions of in-organic (metals and oxides) and organic nano-objects (chitozan and collagen) were subjected to the treatment of direct and alternative electrical fields. In addition to quasi-periodical spatial patterning resonance-like performance of spatial distributions of these suspensions has been found at low frequencies of alternating electrical field. These resonances are explained as the result of creation of equilibrium states of groups of charged nano-objects with opposite signs of charges at the interparticle distances where the forces of Coulomb attraction are compensated by the repulsion forces induced by relatively negative polarization of hydrated regions surrounding the nanoparticles with respect to pure water. The low frequencies of these resonances are explained by comparatively big distances between the particles and their big masses with t\respect to masses of atoms constituting molecules with high resonance frequencies. These new resonances open a new approach to detailed modeling and understanding of mechanisms of the influence of electrical fields on the functioning of internal organs of living organisms at the level of cells and neurons.
285
10003559
Effect of Thickness on Structural and Electrical Properties of CuAlS2 Thin Films Grown by Two Stage Vacuum Thermal Evaporation Technique
Abstract:
This work studies the effect of thickness on structural and electrical properties of CuAlS2 thin films grown by two stage vacuum thermal evaporation technique. CuAlS2 thin films of thicknesses 50nm, 100nm and 200nm were deposited on suitably cleaned corning 7059 glass substrate at room temperature (RT). In the first stage Cu-Al precursors were grown at room temperature by thermal evaporation and in the second stage Cu-Al precursors were converted to CuAlS2 thin films by sulfurisation under sulfur atmosphere at the temperature of 673K. The structural properties of the films were examined by X-ray diffraction (XRD) technique while electrical properties of the specimens were studied using four point probe method. The XRD studies revealed that the films are of crystalline in nature having tetragonal structure. The variations of the micro-structural parameters, such as crystallite size (D), dislocation density ( ), and micro-strain ( ), with film thickness were investigated. The results showed that the crystallite sizes increase as the thickness of the film increases. The dislocation density and micro-strain decreases as the thickness increases. The resistivity (  ) of CuAlS2 film is found to decrease with increase in film thickness, which is related to the increase of carrier concentration with film thickness. Thus thicker films exhibit the lowest resistivity and high carrier concentration, implying these are the most conductive films. Low electrical resistivity and high carrier concentration are widely used as the essential components in various optoelectronic devices such as light-emitting diode and photovoltaic cells.
284
10003558
Dynamic Response of Nano Spherical Shell Subjected to Termo-Mechanical Shock Using Nonlocal Elasticity Theory
Abstract:
In this paper, we present an analytical method for analysis of nano-scale spherical shell subjected to thermo-mechanical shocks based on nonlocal elasticity theory. Thermo-mechanical properties of nano shpere is assumed to be temperature dependent. Governing partial differential equation of motion is solved analytically by using Laplace transform for time domain and power series for spacial domain. The results in Laplace domain is transferred to time domain by employing the fast inverse Laplace transform (FLIT) method. Accuracy of present approach is assessed by comparing the the numerical results with the results of published work in literature. Furtheremore, the effects of non-local parameter and wall thickness on the dynamic characteristics of the nano-sphere are studied.
283
10003557
Study of Hydrocarbons Metering Issues in Algerian Fields under the New Law Context
Abstract:
Since the advent of the law 86/14 concerning the exploitation of the national territory by foreign companies in partnership with the Algerian oil and gas company, the problem of hydrocarbons metering in the sharing production come out. More generally, good management counting hydrocarbons can provide data on the production wells, the field and the reservoir for medium and long term planning, particularly in the context of the management and field development. In this work, we are interested in the transactional metering which is a very delicate and crucial period in the current context of the new hydrocarbon’s law characterized by assets system between the various activities of Sonatrach and its foreign partners. After a state of the art on hydrocarbons metering devices in Algeria and elsewhere, we will decline the advantages and disadvantages of each system, and then we describe the problem to try to reach an optimal solution.
282
10003556
Advanced Numerical and Analytical Methods for Assessing Concrete Sewers and Their Remaining Service Life
Abstract:
Pipelines are extensively used engineering structures which convey fluid from one place to another. Most of the time, pipelines are placed underground and are encumbered by soil weight and traffic loads. Corrosion of pipe material is the most common form of pipeline deterioration and should be considered in both the strength and serviceability analysis of pipes. The study in this research focuses on concrete pipes in sewage systems (concrete sewers). This research firstly investigates how to involve the effect of corrosion as a time dependent process of deterioration in the structural and failure analysis of this type of pipe. Then three probabilistic time dependent reliability analysis methods including the first passage probability theory, the gamma distributed degradation model and the Monte Carlo simulation technique are discussed and developed. Sensitivity analysis indexes which can be used to identify the most important parameters that affect pipe failure are also discussed. The reliability analysis methods developed in this paper contribute as rational tools for decision makers with regard to the strengthening and rehabilitation of existing pipelines. The results can be used to obtain a cost-effective strategy for the management of the sewer system.
281
10003555
Protein Quality of Game Meat Hunted in Latvia
Abstract:
Not all proteins have the same nutritional value, since protein quality strongly depends on its amino acid composition and digestibility. The meat of game animals could be a high protein source because of its well-balanced essential amino acids composition. Investigations about biochemical composition of game meat such as wild boar (Sus scrofa scrofa), roe deer (Capreolus capreolus) and beaver (Castor fiber) are not very much. Therefore, the aim of the investigation was evaluate protein composition of game meat hunted in Latvia. The biochemical analysis, evaluation of connective tissue and essential amino acids in meat samples were done, the amino acids score were calculate. Results of analysis showed that protein content 20.88-22.05% of all types of meat samples is not different statistically. The content of connective tissue from 1.3% in roe deer till 1.5% in beaver meat allowed classified game animal as high quality meat. The sum of essential amino acids in game meat samples were determined 7.05–8.26g100g-1. Roe deer meat has highest protein content and lowest content of connective tissues among game meat hunted in Latvia. Concluded that amino acid score for limiting amino acids phenylalanine and tyrosine is high and shows high biological value of game meat.
280
10003554
Effective Work Roll Cooling toward Stand Reduction in Hot Strip Process
Abstract:
The maintenance of work rolls in hot strip processing has been lengthy and difficult tasks for hot strip manufacturer because heavy work rolls have to be taken out of the production line, which could take hours. One way to increase the time between maintenance is to improve the effectiveness of the work roll cooling system such that the wear and tear more slowly occurs, while the operation cost is kept low. Therefore, this study aims to improve the work roll cooling system by providing the manufacturer the relationship between the work-roll temperature reduced by cooling and the water flow that can help manufacturer determining the more effective water flow of the cooling system. The relationship is found using simulation with a systematic process adjustment so that the satisfying quality of product is achieved. Results suggest that the manufacturer could reduce the water flow by 9% with roughly the same performance. With the same process adjustment, the feasibility of finishing-mill-stand reduction is also investigated. Results suggest its possibility.
279
10002947
Hybrid Pulse Width Modulation Techniques for the Reduction of Switching Losses and Voltage Harmonics in Cascaded Multilevel Inverters
Abstract:

These days, the industrial trend is moving away from heavy and bulky passive components to power converter systems that use more and more semiconductor elements. Also, it is difficult to connect the traditional converters to the high and medium voltage. For these reasons, a new family of multilevel inverters has appeared as a solution for working with higher voltage levels. Different modulation topologies like Sinusoidal Pulse Width Modulation (SPWM), Selective Harmonic Elimination Pulse Width Modulation (SHE-PWM) are available for multilevel inverters. In this work, different hybrid modulation techniques which are combination of fundamental frequency modulation and multilevel sinusoidal-modulation are compared. The main characteristic of these modulations are reduction of switching losses with good harmonic performance and balanced power loss dissipation among the device. The proposed hybrid modulation schemes are developed and simulated in Matlab/Simulink for cascaded H-bridge inverter. The results validate the applicability of the proposed schemes for cascaded multilevel inverter.

278
10002648
Biologically Active Caffeic Acid-Derived Biopolymer
Abstract:

The high-molecular water-soluble preparations from several species of two genera (Symphytum and Anchusa) of Boraginaceae family Symphytum asperum, S. caucasicum, S.officinale and Anchusa italica were isolated. According to IR, 13C and 1H NMR, APT, 1D NOE, 2D heteronuclear 1H/13C HSQC and 2D DOSY experiments, the main chemical constituent of these preparations was found to be caffeic acid-derived polyether, namely poly[3-(3,4-dihydroxyphenyl)glyceric acid] (PDPGA) or poly[oxy-1- carboxy-2-(3,4-dihydroxyphenyl)ethylene]. Most carboxylic groups of this caffeic acid-derived polymer of A. italica are methylated.

277
10002350
Evaluation of Fuel Properties of Six Tropical Hardwood Timber Species for Briquettes
Abstract:
The fuel potential of six tropical hardwood species namely: Triplochiton scleroxylon, Ceiba pentandra, Aningeria robusta, Terminalia superba, Celtis mildbreadii and Piptadenia africana were studied. Properties studied included species density, gross calorific value, volatile matter, ash content, organic carbon and elemental composition. Fuel properties were determined using standard laboratory methods. The result indicates that the gross calorific value (GCV) of the species ranged from 20.16 to 22.22 MJ/kg and they slightly varied from each other. Additionally, the GCV of the biomass materials were higher than that of other biomass materials like; wheat straw, rice straw, maize straw and sugar cane. The ash and volatile matter content varied from 0.6075 to 5.0407%, and 75.23% to 83.70% respectively. The overall rating of the properties of the six biomass materials suggested that Piptadenia africana has the best fuel property to be used as briquettes and Aningeria robusta the worse. This study therefore suggests that a holistic assessment of a biomass material needs to be done before selecting it for fuel purpose.
276
10002288
Effect of Calving Season on the Economic and Production Efficiency of Dairy Production Breeds
Abstract:
The objective of this study was to evaluate the effects of calving season on the production and economic efficiency of dairy farms in Egypt. Our study was performed at dairy production farms in the Alexandria, Behera, and Kafr El-Sheikh provinces of Egypt from summer 2010 to winter 2013. The randomly selected dairy farms had herds consisting of Baladi, Holstein-Friesian, or cross-bred (Baladi × Holstein-Friesian) cows. The data were collected from production records and responses to a structured questionnaire. The average total return differed significantly (P < 0.05) between the different cattle breeds and calving seasons. The average total return was highest for the Holstein- Friesian cows that calved in the winter (29106.42 EGP/cow/year), and it was lowest for Baladi cows that calved in the summer (12489.79 EGP/cow/year). Differences in total returns between the cows that calved in the winter or summer or between the foreign and native breeds, as well as variations in calf prices, might have contributed to the differences in milk yield. The average net profit per cow differed significantly (P < 0.05) between the cattle breeds and calving seasons. The average net profit values for the Baladi cows that calved in the winter or summer were 2413 and 2994.96 EGP/cow/year, respectively, and those for the Holstein- Friesian cows were 10744.17 and 7860.56 EGP/cow/year, respectively, whereas those for the cross-bred cows were 10174.86 and 7571.33 EGP/cow/year, respectively. The variations in net profit might have resulted from variation in the availability or price of feed materials, milk prices, or sales volumes. Our results show that the breed and calving season of dairy cows significantly affected the economic efficiency of dairy farms in Egypt. The cows that calved in the winter produced more milk than those that calved in the summer, which may have been the result of seasonal influences, such as temperature, humidity, management practices, and the type of feed or green fodder available.
Keywords:
275
10002165
The Impact of Surface Roughness and PTFE/TiF3/FeF3 Additives in Plain ZDDP Oil on the Friction and Wear Behavior Using Thermal and Tribological Analysis under Extreme Pressure Condition
Abstract:

The use of titanium fluoride and iron fluoride (TiF3/FeF3) catalysts in combination with polutetrafluoroethylene (PTFE) in plain zinc- dialkyldithiophosphate (ZDDP) oil is important for the study of engine tribocomponents and is increasingly a strategy to improve the formation of tribofilm and provide low friction and excellent wear protection in reduced phosphorus plain ZDDP oil. The influence of surface roughness and the concentration of TiF3/FeF3/PTFE were investigated using bearing steel samples dipped in lubricant solution at 100°C for two different heating time durations. This paper addresses the effects of water drop contact angle using different surface; finishes after treating them with different lubricant combination. The calculated water drop contact angles were analyzed using Design of Experiment software (DOE) and it was determined that a 0.05 μm Ra surface roughness would provide an excellent TiF3/FeF3/PTFE coating for antiwear resistance as reflected in the Scanning electron microscopy (SEM) images and the tribological testing under extreme pressure conditions. Both friction and wear performance depend greatly on the PTFE/and catalysts in plain ZDDP oil with 0.05 % phosphorous and on the surface finish of bearing steel. The friction and wear reducing effects, which was observed in the tribological tests, indicated a better micro lubrication effect of the 0.05 μm Ra surface roughness treated at 100°C for 24 hours when compared to the 0.1 μm Ra surface roughness with the same treatment.

274
10001086
Various Advanced Statistical Analyses of Index Values Extracted from Outdoor Agricultural Workers Motion Data
Abstract:

We have been grouping and developing various kinds of practical, promising sensing applied systems concerning agricultural advancement and technical tradition (guidance). These include advanced devices to secure real-time data related to worker motion, and we analyze by methods of various advanced statistics and human dynamics (e.g. primary component analysis, Ward system based cluster analysis, and mapping). What is more, we have been considering worker daily health and safety issues. Targeted fields are mainly common farms, meadows, and gardens. After then, we observed and discussed time-line style, changing data. And, we made some suggestions. The entire plan makes it possible to improve both the aforementioned applied systems and farms.

273
10001063
Physiological Action of Anthraquinone-Containing Preparations
Abstract:

In review the generalized data about biological activity of anthraquinone-containing plants and specimens on their basis is presented. Data of traditional medicine, results of bioscreening and clinical researches of specimens are analyzed.

272
10001036
Biosynthesis and Metabolism of Anthraquinone Derivatives
Abstract:

In review the generalized data about biosynthetic routs formation anthraquinone molecules in natural cells. The basic possibilities of various ways of biosynthesis of different quinoid substances are shown.

271
10000990
Study of Reporting System for Adverse Events Related to Common Medical Devices at a Tertiary Care Public Sector Hospital in India
Abstract:

Advances in the use of health care technology have resulted in increased adverse events (AEs) related to the use of medical devices. The study focused on the existing reporting systems. This study was conducted in a tertiary care public sector hospital. Devices included Syringe infusion pumps, Cardiac monitors, Pulse oximeters, Ventilators and Defibrillators. A total of 211 respondents were recruited. Interviews were held with 30 key informants. Medical records were scrutinized. Relevant statistical tests were used. Resident doctors reported maximum frequency of AEs, followed by nurses; and least by consultants. A significant association was found between the cadre of health care personnel and awareness that the patients and bystanders have a risk of sustaining AE. Awareness regarding reporting of AEs was low, and it was generally done verbally. Other critical findings are discussed in the light of the barriers to reporting, reasons for non-compliance, recording system, and so on.

270
10000983
Two Kinds of Self-Oscillating Circuits Mechanically Demonstrated
Abstract:

This study introduces two types of self-oscillating circuits that are frequently found in power electronics applications. Special effort is made to relate the circuits to the analogous mechanical systems of some important scientific inventions: Galileo’s pendulum clock and Coulomb’s friction model. A little touch of related history and philosophy of science will hopefully encourage curiosity, advance the understanding of self-oscillating systems and satisfy the aspiration of some students for scientific literacy. Finally, the two self-oscillating circuits are applied to design a simple class-D audio amplifier.

269
10000338
Blind Identification and Equalization of CDMA Signals Using the Levenvberg-Marquardt Algorithm
Abstract:

In this paper we describe the Levenvberg-Marquardt (LM) algorithm for identification and equalization of CDMA signals received by an antenna array in communication channels. The synthesis explains the digital separation and equalization of signals after propagation through multipath generating intersymbol interference (ISI). Exploiting discrete data transmitted and three diversities induced at the reception, the problem can be composed by the Block Component Decomposition (BCD) of a tensor of order 3 which is a new tensor decomposition generalizing the PARAFAC decomposition. We optimize the BCD decomposition by Levenvberg-Marquardt method gives encouraging results compared to classical alternating least squares algorithm (ALS). In the equalization part, we use the Minimum Mean Square Error (MMSE) to perform the presented method. The simulation results using the LM algorithm are important.

268
10000124
Hybrid RANS-LES Simulation of In-Cylinder Air Flow for Different Engine Speeds at Fixed Intake Flow Pressure
Abstract:

The in-cylinder flow and mixture formations are significant in view of today’s increasing concern on environmental issues and stringent emission regulations. In this paper, the numerical simulations of a SI engine at different engine speeds (2000-5000 rpm) at fixed intake flow pressure of 1 bar are studied using the AVL FIRE software. The simulation results show that when the engine speed at fixed intake flow pressure is increased, the volumetric efficiency of the engine decreases. This is due to a richer fuel conditions near the engine cylinder wall when engine speed is increased. Significant effects of impingement are also noted on the upper and side walls of the engine cylinder. These variations in mixture formation before ignition could affect the thermodynamics efficiency and specific fuel consumption that would lead to a reduced engine performance.

267
10000123
Enhanced Bidirectional Selection Sort
Authors:
Abstract:

An algorithm is a well-defined procedure that takes some input in the form of some values, processes them and gives the desired output. It forms the basis of many other algorithms such as searching, pattern matching, digital filters etc., and other applications have been found in database systems, data statistics and processing, data communications and pattern matching. This paper introduces algorithmic “Enhanced Bidirectional Selection” sort which is bidirectional, stable. It is said to be bidirectional as it selects two values smallest from the front and largest from the rear and assigns them to their appropriate locations thus reducing the number of passes by half the total number of elements as compared to selection sort.

266
10000007
Characteristics of Aluminum Hybrid Composites
Abstract:

Aluminum hybrid reinforcement technology is a response to the dynamic ever increasing service requirements of such industries as transportation, aerospace, automobile, marine, etc. It is unique in that it offers a platform of almost unending combinations of materials to produce various hybrid composites. This article reviews the studies carried out on various combinations of aluminum hybrid composite and the effects on mechanical, physical and chemical properties. It is observed that the extent of enhancement of these properties of hybrid composites is strongly dependent on the nature of the reinforcement, its hardness, particle size, volume fraction, uniformity of dispersion within the matrix and the method of hybrid production.

265
10000006
Particle Swarm Optimization Based Interconnected Hydro-Thermal AGC System Considering GRC and TCPS
Abstract:

This paper represents performance of particle swarm optimisation (PSO) algorithm based integral (I) controller and proportional-integral controller (PI) for interconnected hydro-thermal automatic generation control (AGC) with generation rate constraint (GRC) and Thyristor controlled phase shifter (TCPS) in series with tie line. The control strategy of TCPS provides active control of system frequency. Conventional objective function integral square error (ISE) and another objective function considering square of derivative of change in frequencies of both areas and change in tie line power are considered. The aim of designing the objective function is to suppress oscillation in frequency deviations and change in tie line power oscillation. The controller parameters are searched by PSO algorithm by minimising the objective functions. The dynamic performance of the controllers I and PI, for both the objective functions, are compared with conventionally optimized I controller.

264
9999852
Influence of Probiotics on Dairy Cows Diet
Abstract:

The main goal of this paper was evaluate the effect of diets containing different levels of probiotic on performance and milk composition of lactating cows. Eight Holstein cows were distributed in two 4x4 Latin square. The diets were based on corn silage, concentrate and the treatment (0, 3, 6 or 9 grams of probiotic/animal/day). It was evaluated the dry matter intake of nutrients, milk yield and composition. The use of probiotics did not affect the nutrient intake (p>0.05) neither the daily milk production or corrected to 4% fat (p>0.05). However, it was observed that there was a significant fall in milk composition with higher levels of probiotics supplementation. These results emphasize the need of further studies with different experimental designs or improve the number of Latin square with longer periods of adaptation.

263
9999851
Neighborhood Sustainability Assessment in the New Developments of Tabriz (Case Study: Roshdieh)
Abstract:

Since, today in most countries around the world much attention is paid to planning the smallest unit in the city i.e. the residential neighborhoods to achieve sustainable urban development goals, a variety of assessment tools have been developed to assess and monitor the sustainability of new developments. One of the most reliable and widely used assessment tools is LEED-ND rating system. This paper whit the aim of assessing sustainability level of Roshdieh neighborhood in Tabriz, has introduced this rating system and applied it in the study area. The results indicate that Roshdieh has the potential of achieving the standards of sustainable neighborhoods, but the present situation is far from the ideal point.

262
9999824
Mercury Removing Capacity of Multiwall Carbon Nanotubes as Detected by Cold Vapor Atomic Absorption Spectroscopy: Kinetic & Equilibrium Studies
Abstract:

Multiwall carbon nanotubes, prepared by chemical vapor deposition, have an average diameter of 60-100 nm as shown by High Resolution Transmittance Electron Microscope, HR-TEM. The Multiwall carbon nanotubes (MWCNTs) were further characterized using X-ray Diffraction and Raman Spectroscopy. Mercury uptake capacity of MWCNTs was studied using batch adsorption method at different concentration ranges up to 150 ppm. Mercury concentration (before and after the treatment) was measured using cold vapor atomic absorption spectroscopy. The effect of time, concentration, pH and adsorbent dose were studied. MWCNT were found to perform complete absorption in the sub-ppm concentrations (parts per billion levels) while for high concentrations, the adsorption efficiency was 92% at the optimum conditions; 0.1 g of the adsorbent at 150 ppm mercury (II) solution. The adsorption of mercury on MWCNTs was found to follow the Freundlich adsorption isotherm and the pseudo-second order kinetic model.

261
9999822
Forecasting US Dollar/Euro Exchange Rate with Genetic Fuzzy Predictor
Abstract:

Fuzzy systems have been successfully used for exchange rate forecasting. However, fuzzy system is very confusing and complex to be designed by an expert, as there is a large set of parameters (fuzzy knowledge base) that must be selected, it is not a simple task to select the appropriate fuzzy knowledge base for an exchange rate forecasting. The researchers often look the effect of fuzzy knowledge base on the performances of fuzzy system forecasting. This paper proposes a genetic fuzzy predictor to forecast the future value of daily US Dollar/Euro exchange rate time’s series. A range of methodologies based on a set of fuzzy predictor’s which allow the forecasting of the same time series, but with a different fuzzy partition. Each fuzzy predictor is built from two stages, where each stage is performed by a real genetic algorithm.

260
9999731
Yield Onset of Thermo-Mechanical Loading of FGM Thick Walled Cylindrical Pressure Vessels
Abstract:

In this paper, thick walled Cylindrical tanks or tubes made of functionally graded material under internal pressure and temperature gradient are studied. Material parameters have been considered as power functions. They play important role in the elastoplastic behavior of these materials. To clarify their role, different materials with different parameters have been used under temperature gradient. Finally, their effect and loading effect have been determined in first yield point. Also, the important role of temperature gradient was also shown. At the end the study has been results obtained from changes in the elastic modulus and yield stress. Also special attention is also given to the effects of this internal pressure and temperature gradient in the creation of tensile and compressive stresses.

259
9999676
Intuitionistic T-S Fuzzy Subalgebras and Ideals in BCI-algebras
Abstract:

The aim of this paper is to introduce the notions of intuitionistic T-S fuzzy subalgebras and intuitionistic T-S fuzzy ideals in BCI-algebras, and then to investigate their basic properties.

258
9999580
Application of Vortex Induced Vibration Energy Generation Technologies to the Offshore Oil and Gas Platform: The Preliminary Study
Abstract:

The global demand for continuous and eco-friendly renewable energy as alternative to fossils fuels is large and ever growing in nowadays. This paper will focus on capability of Vortex Induced Vibration (VIV) phenomenon in generating alternative energy for offshore platform application. In order to maximize the potential of energy generation, the effects of lock in phenomenon and different geometries of cylinder were studied in this project. VIV is the motion induced on bluff body which creates alternating lift forces perpendicular to fluid flow. Normally, VIV is unwanted in order to prevent mechanical failure of the vibrating structures. But in this project, instead of eliminating these vibrations, VIV will be exploited to transform these vibrations into a valuable resource of energy.

257
9999579
The Effect of Displacement on Indigenous Tribes’ Socio-Culture and Food Practices
Abstract:

This paper reports the empirical investigation on the effect of involuntary displacement of indigenous tribes on their sociocultural and food practices. A descriptive research design using the quantitative approach was applied and individual of indigenous tribes as unit of analysis. Through a self-administered survey among two selected Malaysia indigenous tribes, one hundred fifty questionnaires were successfully collected. With the application of descriptive and inferential statistic some useful insights pertaining to the issue investigated was significantly obtained. Findings revealed that improvement on the socio-culture, economy and knowledge is apparent on the indigenous groups’ resulted from displacement program. Displacement also has a slight impact on indigenous groups’ food practices. These positive indications provide significant implications, not only for the indigenous groups themselves, but also for the responsible authorities.

256
9999578
Heritability and Repeatability Estimates of Some Measurable Traits in Meat Type Chickens Reared for Ten Weeks in Abeokuta, Nigeria
Abstract:

A total of 150 meat type chickens comprising 50 each of Arbor Acre, Marshall and Ross were used for this study which lasted for 10 weeks at the Federal University of Agriculture, Abeokuta, Nigeria. Growth performance data were collected from the third week through week 10 and data obtained were analysed using the Generalized Linear Model Procedure. Heritability estimates (h2) for body dimensions carried out on the chicken strains ranged from low to high. Marshall broiler chicken strain had the highest h2 for body weight 0.46±0.04, followed by Arbor Acre and Ross with h2 being 0.38±0.12 and 0.26±0.06, respectively. The repeatability estimates for body weight in the three broiler strains were high, and it ranged from 0.70 at week 4 to 0.88 at week 10. Relationships between the body weight and linear body measurements in the broiler chicken strains were positive and highly significant (p > 0.05).

255
9999577
The Co-application of Plant Growth Promoting Rhizobacteria and Inoculation with Rhizobium Bacteria on Grain Yield and Its Components of Mungbean (Vigna radiate L.) in Ilam Province, Iran
Abstract:

In order to investigate the effect of Plant Growth Promoting Rhizobacteria (PGPR) and rhizobium bacteria on grain yield and some agronomic traits of mungbean (Vigna radiate L.), an experiment was carried out based on randomized complete block design with three replications in Malekshahi, Ilam province, Iran during 2012-2013 cropping season. Experimental treatments consisted of control treatment, inoculation with rhizobium bacteria, rhizobium bacteria and Azotobacter, rhizobium bacteria and Azospirillum, rhizobium bacteria and Pseudomonas, rhizobium bacteria, Azotobacter and Azospirillum, rhizobium bacteria, Azotobacter and Pseudomonas, rhizobium bacteria, Azospirillum and Pseudomonas and rhizobium bacteria, Azotobacter, Azospirillum and Pseudomonas. The results showed that the effect of PGPR and rhizobium bacteria were significant affect on grain and its components in mungbean plant. Grain yield significantly increased by PGPR and rhizobium bacteria, so that the maximum grain yield was obtained from rhizobium bacteria + Azospirillum + Pseudomonas with the amount of 2287 kg.ha-1 as compared to control treatment. Excessive application of chemical fertilizers causes environmental and economic problems. That is, the overfertilization of P and N leads to pollution due to soil erosion and runoff water, so the use of PGPR and rhizobium bacteria can be justified due to reduce input costs, increase in grain yield and environmental friendly.

254
9999576
The Application of Hybrid Orthonomal Bernstein and Block-Pulse Functions in Finding Numerical Solution of Fredholm Fuzzy Integral Equations
Abstract:

In this paper, we have proposed a numerical method for solving fuzzy Fredholm integral equation of the second kind. In this method a combination of orthonormal Bernstein and Block-Pulse functions are used. In most cases, the proposed method leads to the exact solution. The advantages of this method are shown by an example and calculate the error analysis.

253
9999480
Decision Support System for Tourism in Northern Part of Thailand
Abstract:

The purposes of this study were to design and find users’ satisfaction after using the decision support system for tourism northern part of Thailand, which can provide tourists touristic information and plan their personal voyage. Such information can be retrieved systematically based on personal budget and provinces. The samples of this study were five experts and users 30 persons white collars in Bangkok. This decision support system was designed via ASP.NET. Its database was developed by using MySQL, for administrators are able to effectively manage the database. The application outcome revealed that the innovation works properly as sought in objectives. Specialists and white collars in Bangkok have evaluated the decision support system; the result was satisfactorily positive.

252
9999390
Observation and Study of Landslides Affecting the Tangier – Oued R’mel Motorway Segment
Abstract:

The motorway segment between Tangier and Oued R’mel has experienced, since the beginning of building works, significant instability and landslides linked to a number of geological, hydrogeological and geothermic factors affecting the different formations. The landslides observed are not fully understood, despite many studies conducted on this segment. This study aims at producing new methods to better explain the phenomena behind the landslides, taking into account the geotechnical and geothermic contexts. This analysis builds up on previous studies and geotechnical data collected in the field. The final body of data collected shall be processed through the Plaxis software for a better and customizable view of the landslide problems in the area, which will help tofind solutions and stabilize land in the area.

251
9999389
Consumption Habits of Low-Fat Plant Sterol-Enriched Yoghurt Enriched with Phytosterols
Abstract:

The increasing interest in plant sterol enriched foods is due to the fact that they reduce blood cholesterol concentrations without adverse side effects. In this context, enriched foods with phytosterols may be helpful in protecting population against atherosclerosis and cardiovascular diseases. The aim of the present work was to evaluate in a population of Viseu, Portugal, the consumption habits low-fat, plant sterol-enriched yoghurt. For this study, 577 inquiries were made and the sample was randomly selected for people shopping in various supermarkets. The preliminary results showed that the biggest consumers of these products were women aged 45 to 65 years old. Most of the people who claimed to buy these products consumed them once a day. Also, most of the consumers under antidyslipidemic therapeutics noticed positive effects on hypercholesterolemia.

250
9999388
Gas Flaring in the Niger Delta Nigeria: An Act of Inhumanity to Man and His Environment
Abstract:

The Niger Delta Region of Nigeria is home to about 20 million people and 40 different ethnic groups. The region has an area of seventy thousand square kilometers (70,000 KM2) of wetlands, formed primarily by sediments deposition and makes up 7.5 percent of Nigeria's total landmass. The notable ecological zones in this region includes: coastal barrier islands; mangrove swamp forests; fresh water swamps; and lowland rainforests. This incredibly naturally-endowed ecosystem region, which contains one of the highest concentrations of biodiversity on the planet, in addition to supporting abundant flora and fauna, is threatened by the inhuman act known as gas flaring. Gas flaring is the combustion of natural gas that is associated with crude oil when it is pumped up from the ground. In petroleum-producing areas such as the Niger Delta region of Nigeria where insufficient investment was made in infrastructure to utilize natural gas, flaring is employed to dispose of this associated gas. This practice has impoverished the communities where it is practiced, with attendant environmental, economic and health challenges. This paper discusses the adverse environmental and health implication associated with the practice, the role of Government, Policy makers, Oil companies and the Local communities aimed at bring this inhuman practice to a prompt end.

249
9999387
Antioxidant and Aِntimicrobial Properties of Peptides as Bioactive Components in Beef Burger
Abstract:

Dried soy protein hydrolysate powder was added to the burger in order to enhance the oxidative stability as well as decreases the microbial spoilage. The soybean bioactive compounds (soy protein hydrolysate) as antioxidant and antimicrobial were added at level of 1, 2 and 3 %.Chemical analysis and physical properties were affected by protein hydrolysate addition. The TBA values were significantly affected (P < 0.05) by the storage period and the level of soy protein hydrolysate. All the tested soybean protein hydrolysate additives showed strong antioxidant properties. Samples of soybean protein hydrolysate showed the lowest (P < 0.05) TBA values at each time of storage. The counts of all determined microbiological indicators were significantly (P < 0.05) affected by the addition of the soybean protein hydrolysate. Decreasing trends of different extent were also observed in samples of the treatments for total viable counts, Coliform, Staphylococcus aureus, yeast and molds. Storage period was being significantly (P < 0.05) affected on microbial counts in all samples Staphylococcus aureus were the most sensitive microbe followed by Coliform group of the sample containing protein hydrolysate, while molds and yeast count showed a decreasing trend but not significant (P < 0.05) until the end of the storage period compared with control sample. Sensory attributes were also performed, added protein hydrolysate exhibits beany flavor which was clear about samples of 3% protein hydrolysate.

248
9999310
Evaluation of Natural Drainage Flow Pattern, Necessary for Flood Control, Using Digitized Topographic Information: A Case Study of Bayelsa State Nigeria
Abstract:

The need to evaluate and understand the natural drainage pattern in a flood prone, and fast developing environment is of paramount importance. This information will go a long way to help the town planners to determine the drainage pattern, road networks and areas where prominent structures are to be located. This research work was carried out with the aim of studying the Bayelsa landscape topography using digitized topographic information, and to model the natural drainage flow pattern that will aid the understanding and constructions of workable drainages. To achieve this, digitize information of elevation and coordinate points were extracted from a global imagery map. The extracted information was modeled into 3D surfaces. The result revealed that the average elevation for Bayelsa State is 12 m above sea level. The highest elevation is 28 m, and the lowest elevation 0 m, along the coastline. In Yenagoa the capital city of Bayelsa were a detail survey was carried out showed that average elevation is 15 m, the highest elevation is 25 m and lowest is 3 m above the mean sea level. The regional elevation in Bayelsa, showed a gradation decrease from the North Eastern zone to the South Western Zone. Yenagoa showed an observed elevation lineament, were low depression is flanked by high elevation that runs from the North East to the South west. Hence, future drainages in Yenagoa should be directed from the high elevation, from South East toward the North West and from the North West toward South East, to the point of convergence which is at the center that flows from South East toward the North West. Bayelsa when considered on a regional Scale, the flow pattern is from the North East to the South West, and also North South. It is recommended that in the event of any large drainage construction at municipal scale, it should be directed from North East to the South West or from North to South. Secondly, detail survey should be carried out to ascertain the local topography and the drainage pattern before the design and construction of any drainage system in any part of Bayelsa.

247
9999309
Modification of the Conventional Power Flow Analysis for the Deployment of an HVDC Grid System in the Indian Subcontinent
Authors:
Abstract:

The Indian subcontinent is facing a massive challenge with regards to the energy security in member countries, i.e. providing a reliable source of electricity to facilitate development across various sectors of the economy and thereby achieve the developmental targets it has set for itself. A highly precarious situation exists in the subcontinent which is observed in the series of system failures which most of the times leads to system collapses-blackouts. To mitigate the issues related with energy security as well as keep in check the increasing supply demand gap, a possible solution that stands in front of the subcontinent is the deployment of an interconnected electricity ‘Supergrid’ designed to carry huge quanta of power across the sub continent as well as provide the infra structure for RES integration. This paper assesses the need and conditions for a Supergrid deployment and consequently proposes a meshed topology based on VSC HVDC converters for the Supergrid modeling.

246
9999262
Nonlinear Adaptive PID Control for a Semi-Batch Reactor Based On an RBF Network
Abstract:

Control of a semi-batch polymerization reactor using an adaptive radial basis function (RBF) neural network method is investigated in this paper. A neural network inverse model is used to estimate the valve position of the reactor; this method can identify the controlled system with the RBF neural network identifier. The weights of the adaptive PID controller are timely adjusted based on the identification of the plant and self-learning capability of RBFNN. A PID controller is used in the feedback control to regulate the actual temperature by compensating the neural network inverse model output. Simulation results show that the proposed control has strong adaptability, robustness and satisfactory control performance and the nonlinear system is achieved.

245
9999261
The Coexistence of Dual Form of Malnutrition among Portuguese Institutionalized Elderly People
Abstract:

In the present study we evaluated the nutritional status of 214 institutionalized elderly residents of both genders, aged 65 years and older of 11 care homes located in the district of Viseu (center of Portugal). The evaluation was based on anthropometric measurements and the Mini Nutritional Assessment (MNA) score.

The mean age of the subjects was 82.3 ± 6.1 years-old. Most of the elderly residents were female (72.0%). The majority had 4 years of formal education (51.9%) and was widowed (74.3%) or married (14.0%).

Men presented a mean age of 81.2±8.5 years-old, weight 69.3±14.5 kg and BMI 25.33±6.5 kg/m2. In women, the mean age was 84.5±8.2 years-old, weight 61.2±14.7 kg and BMI 27.43±5.6 kg/m2.

The evaluation of the nutritional status using the MNA score showed that 24.0% of the residents show a risk of undernutrition and 76.0% of them were well nourished.

There was a high prevalence of obese (24.8%) and overweight residents (33.2%) according to the BMI. 7.5% were considered underweight.

We also found that according to their waist circumference measurements 88.3% of the residents were at risk for cardiovascular disease (CVD) and 64.0% of them presented very high risk for CVD (WC≥88 cm for women and WC ≥102 cm for men).

The present study revealed the coexistence of a dual form of malnutrition (undernourished and overweight) among the institutionalized Portuguese concomitantly with an excess of abdominal adiposity. The high prevalence of residents at high risk for CVD should not be overlooked.

Given the vulnerability of the group of institutionalized elderly, our study highlights the importance of the classification of nutritional status based on both instruments: the BMI and the MNA.

244
9999260
The Effects of 2wt% Cu Addition on the Corrosion Behavior of Heat Treated Al-6Si-0.5Mg-2Ni Alloy
Abstract:

Al-Si-Mg-Ni(-Cu) alloys are widely used in the automotive industry. They have the advantage of low weight associated with low coefficient of thermal expansion and excellent mechanical properties – mainly at high temperatures. The corrosion resistance of these alloys in coastal area, particularly sea water, however is not yet known. In this investigation, electrochemical impedance spectroscopy (EIS) and potentiodynamic polarization have been used to evaluate the corrosion resistance of Al-6Si-0.5Mg-2Ni (-2Cu) alloys in simulated sea water environments. The potentiodynamic polarization curves reveal that 2 wt% Cu content alloy (Alloy-2) is more prone to corrosion than the Cu free alloy (Alloy-1). But the EIS test results showed that corrosion resistance or charge transfer resistance (Rct) increases with the addition of Cu. Due to addition of Cu and thermal treatment, the magnitude of open circuit potential (OCP), corrosion potential (Ecorr) and pitting corrosion potential (Epit) of Al-6Si-0.5Mg-2Ni alloy in NaCl solution were shifted to the more noble direction.

243
9999259
Implementation of Intuitionistic Fuzzy Approach in Maximizing Net Present Value
Abstract:

The applicability of Net Present Value (NPV) in an investment project is becoming more and more popular in the field of engineering economics. The classical NPV methodology involves only the precise and accurate data of the investment project. In the present communication, we give a new mathematical model for NPV which uses the concept of intuitionistic fuzzy set theory. The proposed model is based on triangular intuitionistic fuzzy number, which may be known as Intuitionistic Fuzzy Net Present Value (IFNPV). The model has been applied to an example and the results are presented.

242
9999248
Incessant Collapse of Buildings in Nigeria: The Possible Role of the Use of Inappropriate Cement Grade/Strength Class
Abstract:

The use of low quality concrete has been identified as one of the main causes of the incessant collapse of buildings in Nigeria. Emphasis has been on the use of poor quality aggregates, poor workmanship and the use of lean concrete mix with low cement quantity as the reasons for the low quality of concrete used for building construction in Nigeria. Surveys conducted revealed that in the construction of most privately owned buildings where concrete trial mixes and concrete compressive strength quality assurance tests are not conducted, concretes used for building constructions are produced using the 1:2:4 mix ratio irrespective of the cement grade/strength class. In this paper, the possible role of the use of inappropriate cement grade/strength class as a cause of the incessant collapse of building in Nigeria is investigated. Investigation revealed that the compressive strengths of concrete cubes produced with Portland-limestone cement grade 32.5 using 1:2:4 and 1:1.5:3 mix ratios are less than the 25MPa and 30MPa cube strengths generally recommended for building superstructures and foundations respectively. Conversely, the compressive strengths of concrete cubes produced with Portland-limestone cement grade 42.5 using 1:2:4 and 1:1.5:3 mix ratios exceed the 25MPa and 30MPa generally recommended for building superstructures and foundations respectively. Thus, it can be concluded that the use of inappropriate cement grade (Portland-limestone cement grade 32.5), particularly for the construction of building foundations is a potential cause of the incessant collapse of buildings in Nigeria. It is recommended that the Standards Organisation of Nigeria should embark on creating awareness for Nigerians, particularly, the home owners and the roadside craftsmen that Portland-limestone cement grade 32.5 should not be used for the construction of building load-carrying members, particularly, building foundations in order to reduce the incessant incidence of collapsed building.

241
9999224
GPS Signal Correction to Improve Vehicle Location during Experimental Campaign
Abstract:

In recent years in Italy the progress of the automobile industry, in the field of reduction of emissions values, is very remarkable. Nevertheless their evaluation and reduction is a key problem, especially in the cities, that account for more than 50% of world population. In this paper we dealt with the problem of describing a quantitatively approach for the reconstruction of GPS coordinates and altitude, in the context of correlation study between driving cycles / emission / geographical location, during an experimental campaign realized with some instrumented cars.

240
9999205
A Study on Integrated Performance of Tap-Changing Transformer and SVC in Association with Power System Voltage Stability
Abstract:

Electricity market activities and a growing demand for electricity have led to heavily stressed power systems. This requires operation of the networks closer to their stability limits. Power system operation is affected by stability related problems, leading to unpredictable system behavior. Voltage stability refers to the ability of a power system to sustain appropriate voltage levels through large and small disturbances. Steady-state voltage stability is concerned with limits on the existence of steady-state operating points for the network. FACTS devices can be utilized to increase the transmission capacity, the stability margin and dynamic behavior or serve to ensure improved power quality. Their main capabilities are reactive power compensation, voltage control and power flow control. Among the FACTS controllers, Static Var Compensator (SVC) provides fast acting dynamic reactive compensation for voltage support during contingency events. In this paper, voltage stability assessment with appropriate representations of tap-changer transformers and SVC is investigated. Integrating both of these devices is the main topic of this paper. Effect of the presence of tap-changing transformers on static VAR compensator controller parameters and ratings necessary to stabilize load voltages at certain values are highlighted. The interrelation between transformer off nominal tap ratios and the SVC controller gains and droop slopes and the SVC rating are found. P-V curves are constructed to calculate loadability margins.

239
9999204
Analysis of Conduction-Radiation Heat Transfer in a Planar Medium: Application of the Lattice Boltzmann Method
Abstract:

In this paper, the 1-D conduction-radiation problem is solved by the lattice Boltzmann method. The effects of various parameters such as the scattering albedo, the conduction–radiation parameter and the wall emissivity are studied. In order to check on the accuracy of the numerical technique employed for the solution of the considered problem, the present numerical code was validated with the published study. The found results are in good agreement with those published

238
9999203
Hysteresis Control of Power Conditioning Unit for Fuel Cell Distributed Generation System
Abstract:

Fuel cell is an emerging technology in the field of renewable energy sources which has the capacity to replace conventional energy generation sources. Fuel cell utilizes hydrogen energy to produce electricity. The electricity generated by the fuel cell can’t be directly used for a specific application as it needs proper power conditioning. Moreover, the output power fluctuates with different operating conditions. To get a stable output power at an economic rate, power conditioning circuit is essential for fuel cell. This paper implements a two-staged power conditioning unit for fuel cell based distributed generation using hysteresis current control technique.

237
9999202
A Study on Physicochemical Analysis of Road and Railway Track Side Soil Samples of Amritsar (Punjab) and Their Genotoxic Effects
Abstract:

Considering the serious health hazards of air pollutants from automobiles, the present study was aimed to estimate the genotoxic/tumor inducing potential of three soil samples collected from junctions of Bus stand (BS), Crystal (CT) and Railway station (RS) of Amritsar, Punjab (India) using Allium cepa root chromosomal aberration assay (AlRCAA) and potato disc tumor assay (PDTA). The genotoxic potential in AlRCAA was 41.27% and 41.26% for BS; 37.89% and 43.38% for RS and 33.76% and 37.83% for CT during in situ and root dip treatments, respectively. The maximum number of tumors were induced in RS sample (64) followed by BS (21) and CT (9) during PDTA. The physicochemical parameters of soil sample were also studied and the concentration of lead was found to be 95.21 mg/Kg in RS, 35.30 mg/Kg in BS and 24.59 mg/Kg in CT samples.

236
9999201
On Measuring the Reusability Proneness of Mobile Applications
Authors:
Abstract:

The abnormal increase in the number of applications available for download in Android markets is a good indication that they are being reused. However, little is known about their real reusability potential. A considerable amount of these applications is reported as having a poor quality or being malicious. Hence, in this paper, an approach to measure the reusability potential of classes in Android applications is proposed. The approach is not meant specifically for this particular type of applications. Rather, it is intended for Object-Oriented (OO) software systems in general and aims also to provide means to discard the classes of low quality and defect prone applications from being reused directly through inheritance and instantiation. An empirical investigation is conducted to measure and rank the reusability potential of the classes of randomly selected Android applications. The results obtained are thoroughly analyzed in order to understand the extent of this potential and the factors influencing it.

235
9999157
Dexamethasone: Impact on Testicular Activity
Abstract:

Dexamethasone (Dex) is a synthetic glucocorticoid that is used in therapy. However prolonged treatments with high doses are often required. This causes side effects that interfere with the activity of several endocrine systems, including the gonadotropic axis. The aim of our study is to determine the effect of Dex on testicular function in prepubertal Wistar rats. Newborn Wistar rats are submitted to intraperitoneal injection of Dex (1μg of Dex dissolved in NaCl 0.9% / 5g bw) for 20 days and then sacrificed at the age of 40days. A control group received NaCl 0.9%. The rat is weighed daily. The plasmatic levels of testosterone, LH and FSH were measured by radioimmunoassay. A histomorphometric study was performed on sections of testis. Treated groups showed a significant decrease in body weight (p < 0.05), testis weight (p < 0.05) and plasma levels of testosterone (p < 0.05), of LH (P < .05) and FSH (p> 0.05). There is a reduction of seminiferous tubules average diameter and also of the seminiferous epithelium thickness with an increasing of lumen tubular. The diameter of the Leydig cells and Sertoli cell nucleus is also significantly reduced. Spermatogenesis is blocked at the stage round spermatid unlike witnesses or elongated spermatid stage is found. These results suggest that Dex administered during neonatal life influences testicular activity in the long term.

234
9999156
Turbine Trip without Bypass Analysis of Kuosheng Nuclear Power Plant Using TRACE Coupling with FRAPTRAN
Abstract:

This analysis of Kuosheng nuclear power plant (NPP) was performed mainly by TRACE, assisted with FRAPTRAN and FRAPCON. SNAP v2.2.1 and TRACE v5.0p3 are used to develop the Kuosheng NPP SPU TRACE model which can simulate the turbine trip without bypass transient. From the analysis of TRACE, the important parameters such as dome pressure, coolant temperature and pressure can be determined. Through these parameters, comparing with the criteria which were formulated by United States Nuclear Regulatory Commission (U.S. NRC), we can determine whether the Kuoshengnuclear power plant failed or not in the accident analysis. However, from the data of TRACE, the fuel rods status cannot be determined. With the information from TRACE and burn-up analysis obtained from FRAPCON, FRAPTRAN analyzes more details about the fuel rods in this transient. Besides, through the SNAP interface, the data results can be presented as an animation. From the animation, the TRACE and FRAPTRAN data can be merged together that may be realized by the readers more easily. In this research, TRACE showed that the maximum dome pressure of the reactor reaches to 8.32 MPa, which is lower than the acceptance limit 9.58 MPa. Furthermore, FRAPTRAN revels that the maximum strain is about 0.00165, which is below the criteria 0.01. In addition, cladding enthalpy is 52.44 cal/g which is lower than 170 cal/g specified by the USNRC NUREG-0800 Standard Review Plan.

233
9999107
Video-Based System for Support of Robot-Enhanced Gait Rehabilitation of Stroke Patients
Abstract:

We present a dedicated video-based monitoring system for quantification of patient’s attention to visual feedback during robot assisted gait rehabilitation. Two different approaches for eye gaze and head pose tracking are tested and compared. Several metrics for assessment of patient’s attention are also presented. Experimental results with healthy volunteers demonstrate that unobtrusive video-based gaze tracking during the robot-assisted gait rehabilitation is possible and is sufficiently robust for quantification of patient’s attention and assessment of compliance with the rehabilitation therapy.

232
9999106
Thai Perception on Bitcoin Value
Abstract:

This research analyzes factors affecting the success of Bitcoin Value within Thailand and develops a guideline for self-reliance for effective business implementation. Samples in this study included 121 people through surveys. The results revealed four main factors affecting the success as follows: 1) A great majority didn't know what Bitcoin was. 2) Didn't grasp the concept of a digital currency or see the benefit of a digital currency. 3) There is a great need to educate the next generation of learners on the benefits of Bitcoin within the community. 4) Future Career training should be pursued in applied Bitcoin development.

The guideline for self-reliance planning consisted of 4 aspects: 1) Local communities need to develop awareness of the usefulness of Bitcoin and share the value of Bitcoin among friends and family. 2) Computer Science and Business Management staff should develop skills to expand on the benefits of Bitcoin within their departments. 3) Further research should be pursued on how Bitcoin Value can improve business and tourism within Thailand. Local communities should focus on developing Bitcoin awareness by encouraging street vendors to accept Bitcoin as another form of payment for services rendered. 4) Development planning: by arranging meet up groups to conduct further education on Bitcoin and share solutions on adoption into every day usage.

231
9999105
Combination Scheme of Affine Projection Algorithm Filters with Complementary Order
Abstract:

This paper proposes a complementary combination scheme of affine projection algorithm (APA) filters with different order of input regressors. A convex combination provides an interesting way to keep the advantage of APA having different order of input regressors. Consequently, a novel APA which has the rapid convergence and the reduced steady-state error is derived. Experimental results show the good properties of the proposed algorithm.

230
9999074
The Design of PFM Mode DC-DC Converter with DT-CMOS Switch
Abstract:

The high efficiency power management IC (PMIC) with switching device is presented in this paper. PMIC is controlled with PFM control method in order to have high power efficiency at high current level. Dynamic Threshold voltage CMOS (DT-CMOS) with low on-resistance is designed to decrease conduction loss. The threshold voltage of DT-CMOS drops as the gate voltage increase, resulting in a much higher current handling capability than standard MOSFET. PFM control circuits consist of a generator, AND gate and comparator. The generator is made to have 1.2MHz oscillation voltage. The DC-DC converter based on PFM control circuit and low on-resistance switching device is presented in this paper.

229
9999073
Opportunistic Routing with Secure Coded Wireless Multicast Using MAS Approach
Abstract:

Many Wireless Sensor Network (WSN) applications necessitate secure multicast services for the purpose of broadcasting delay sensitive data like video files and live telecast at fixed time-slot. This work provides a novel method to deal with end-to-end delay and drop rate of packets. Opportunistic Routing chooses a link based on the maximum probability of packet delivery ratio. Null Key Generation helps in authenticating packets to the receiver. Markov Decision Process based Adaptive Scheduling algorithm determines the time slot for packet transmission. Both theoretical analysis and simulation results show that the proposed protocol ensures better performance in terms of packet delivery ratio, average end-to-end delay and normalized routing overhead.

228
9999040
RBF Modelling and Optimization Control for Semi-Batch Reactors
Abstract:

This paper presents a neural network based model predictive control (MPC) strategy to control a strongly exothermic reaction with complicated nonlinear kinetics given by Chylla-Haase polymerization reactor that requires a very precise temperature control to maintain product uniformity. In the benchmark scenario, the operation of the reactor must be guaranteed under various disturbing influences, e.g., changing ambient temperatures or impurity of the monomer. Such a process usually controlled by conventional cascade control, it provides a robust operation, but often lacks accuracy concerning the required strict temperature tolerances. The predictive control strategy based on the RBF neural model is applied to solve this problem to achieve set-point tracking of the reactor temperature against disturbances. The result shows that the RBF based model predictive control gives reliable result in the presence of some disturbances and keeps the reactor temperature within a tight tolerance range around the desired reaction temperature.

227
9999039
Spatial Time Series Models for Rice and Cassava Yields Based On Bayesian Linear Mixed Models
Abstract:

This paper proposes a linear mixed model (LMM) with spatial effects to forecast rice and cassava yields in Thailand at the same time. A multivariate conditional autoregressive (MCAR) model is assumed to present the spatial effects. A Bayesian method is used for parameter estimation via Gibbs sampling Markov Chain Monte Carlo (MCMC). The model is applied to the rice and cassava yields monthly data which have been extracted from the Office of Agricultural Economics, Ministry of Agriculture and Cooperatives of Thailand. The results show that the proposed model has better performance in most provinces in both fitting part and validation part compared to the simple exponential smoothing and conditional auto regressive models (CAR) from our previous study.

226
9999038
Analysis of EEG Signals Using Wavelet Entropy and Approximate Entropy: A Case Study on Depression Patients
Abstract:

Analyzing brain signals of the patients suffering from the state of depression may lead to interesting observations in the signal parameters that is quite different from a normal control. The present study adopts two different methods: Time frequency domain and nonlinear method for the analysis of EEG signals acquired from depression patients and age and sex matched normal controls. The time frequency domain analysis is realized using wavelet entropy and approximate entropy is employed for the nonlinear method of analysis. The ability of the signal processing technique and the nonlinear method in differentiating the physiological aspects of the brain state are revealed using Wavelet entropy and Approximate entropy.

225
9999037
Behavior of Foreign Tourists Visited Wat Phrachetuponwimolmangkalaram
Abstract:

This research aims to study tourism data and behavior of foreign tourists visited Wat Phrachetuponwimolmangkalaram (Wat Po) Sample groups are tourists who visited inside the temple, during February, March, April and May 2013. Tools used in the research are questionnaires constructed by the researcher, and samples are dawn by Convenience sampling. There are 207 foreign tourists who are willing to be respondents. Statistics used are percentage, average mean and standard deviation. The results of the research reveal that: A. General Data of Respondents The foreign tourists who visited the temple are mostly female (57.5 %), most respondents are aged between 20-29 years (37.2%). Most respondents live in Europe (62.3%), most of them got the Bachelor’s degree (40.1%), British are mostly found (16.4%), respondents who are students are also found (23.2%), and Christian are mostly found (60.9%). B. Tourists’ Behavior While Visiting the Temple Compound. The result shows that the respondents came with family (46.4%), have never visited the temples (40.6%), and visited once (42 %). It is found that the foreign tourists’ inappropriate behavior are wearing revealing attires (58.9%), touching or getting closed to the monks (55.1%), and speaking loudly (46.9%) respectively. The respondents’ outstanding objectives are to visit inside the temple (57.5%), to pay respect to the Reclining Buddha Image in the Viharn (44.4%) and to worship the Buddha image in the Phra Ubosod (37.7%) respectively. C. The Respondents’ Self-evaluation of Performance It is found that over all tourists evaluated themselves in the highest level averaged 4.40. When focusing on each item, it is shown that they evaluated themselves in the highest level on obeying the temple staff averaged 4.57, and cleanness concern of the temple averaged 4.52, well-behaved performance during the temple visit averaged 4.47 respectively.

Keywords:
224
9999036
The Optimum Aeration Time of Wastewater Treatment by Surface Aerators in Suan Sunandha Rajabhat University
Abstract:

This research aimed to study on the efficiency of wastewater treatment by comparing the different aeration times of surface aerators in Suan Sunandha Rajabhat University. In doing so, the operation of surface aerators was divided into 2 groups which included the groups of 8 hours (8-0/opened-closed) and 4 hours (2-2/opened-closed) of aeration time per day. As a result of the study, it was found that the efficiency of wastewater treatment in the forms of DO, BOD, turbidity and NO2- by 8 hours (8-0/opened-closed) and 4 hours (2-2/opened-closed) of aeration time per day of surface aerators was not statistically different [Sig. = .644, .488, .716 and .054 > α (.05)] while the efficiency in the forms of NO3- and P was significantly different at the statistical level of .01 [Sig. = .001 and .000 < α (.01)].

223
9999035
Analysis of High Resolution Seismic Reflection Data to Identify Different Regional Lithologies of the Zaria Batholith Located in the Basement Complex of North Central Nigeria
Abstract:

High resolution seismic reflection has recently been carried out on Zaria batholith, with the aim of characterizing the granitic Zaria batholiths in terms of its lithology. The geology of the area has revealed that the older granite outcrops in the vicinity of Zaria are exposures of a syntectonics to late-tectonic granite batholiths which intruded a crystalline gneissic basement during the Pan-African Orogeny. During the data acquisition the geophone were placed at interval of 1 m, variable offset of 1 and 10 m was used. The common midpoint (CMP) method with 12 fold coverage was employed for the survey. Analysis of the generated 3D surface of the p wave velocities from different profiles for densities and bulk modulus revealed that the rock material is more consolidated in South East part of the batholith and less consolidated in the North Western part. This was in conformity with earlier identified geology of the area, with the South Eastern part majorly of granitic outcrop, while the North Western part is characterized with the exposure of gneisses and thick overburden cover. The difference in lithology was also confirmed by the difference in seismic sections and Arial satellite photograph. Hence two major lithologies were identified, the granitic and gneisses complex which are characterized by gradational boundaries.

222
9999034
Effects of Varying Air Temperature in the Polishing Component of Single-Pass Mill on the Quality of Rice
Abstract:

The effects of varying air temperature (full, ¾ full, ½ full aircon adjustment, no aircon) in polishing component of Single-Pass Mill on the quality of Philippine inbred rice variety, was investigated. Parameters measured were milling recovery (MR), headrice recovery (HR), and percentage with bran streaks. Cooling method (with aircon) increased MR, HR, and percentage with bran streaks of milled rice. Highest MR and HR (67.62%; 47.33%) were obtained from ¾ full adjustment whereas no aircon were lowest (66.27%; 39.76%). Temperature in polishing component at ¾ full adjustment was 33oC whereas no aircon was 45oC. There was increase of 1.35% in MR and 7.57% in HR. Additional cost of milling per kg due to aircon cooling was P0.04 at 300 tons/yr volume, with 0.15 yr payback period. Net income was estimated at ₱98,100.00. Percentage of kernels with bran streaks increased from 5%–14%, indicating more nutrients of milled rice.

221
9999032
An Enhanced SAR-Based Tsunami Detection System
Abstract:

Tsunami early detection and warning systems have proved to be of ultimate importance, especially after the destructive tsunami that hit Japan in March 2012. Such systems are crucial to inform the authorities of any risk of a tsunami and of the degree of its danger in order to make the right decision and notify the public of the actions they need to take to save their lives. The purpose of this research is to enhance existing tsunami detection and warning systems. We first propose an automated and miniaturized model of an early tsunami detection and warning system. The model for the operation of a tsunami warning system is simulated using the data acquisition toolbox of Matlab and measurements acquired from specified internet pages due to the lack of the required real-life sensors, both seismic and hydrologic, and building a graphical user interface for the system. In the second phase of this work, we implement various satellite image filtering schemes to enhance the acquired synthetic aperture radar images of the tsunami affected region that are masked by speckle noise. This enables us to conduct a post-tsunami damage extent study and calculate the percentage damage. We conclude by proposing improvements to the existing telecommunication infrastructure of existing warning tsunami systems using a migration to IP-based networks and fiber optics links.

220
9999010
Surface Roughness Evaluation for EDM of En31 with Cu-Cr-Ni Powder Metallurgy Tool
Abstract:

In this study, Electrical Discharge Machining (EDM) is used to modify the surface of high carbon steel En31 with the help of tool electrode (Copper-Chromium-Nickel) manufactured by powder metallurgy (PM) process. The effect of EDM on surface roughness during surface alloying is studied. Taguchi’s Design of experiment (DOE) and L18 orthogonal array is used to find the best level of input parameters in order to achieve high surface finish. Six input parameters are considered and their percentage contribution towards surface roughness is investigated by analysis of variances (ANOVA). Experimental results show that an hard alloyed surface (1.21% carbon, 2.14% chromium and 1.38% nickel) with surface roughness of 3.19µm can be generated using EDM with PM tool. Additionally, techniques like Scanning Electron Microscope (SEM) and Energy Dispersive Spectroscopy (EDS) are used to analyze the machined surface and EDMed layer composition, respectively. The increase in machined surface micro-hardness (101%) may be related to the formation of carbides containing chromium.

219
9999009
Fractional Order Feedback Control of a Ball and Beam System
Abstract:

In this paper, fractional order feedback control of a ball beam model is investigated. The ball beam model is a particular example of the double Integrator system having strongly nonlinear characteristics and unstable dynamics which make the control of such system a challenging task. Most of the work in fractional order control systems are in theoretical nature and controller design and its implementation in practice is very small. In this work, a successful attempt has been made to design a fractional order PIλDμcontroller for a benchmark laboratory ball and beam model. Better performance can be achieved using a fractional order PID controller and it is demonstrated through simulations results with a comparison to the classic PID controller.

218
9999008
Combustion and Emission Characteristics in a Can-type Combustion Chamber
Abstract:

Combustion phenomenon will be accomplished effectively by the development of low emission combustor. One of the significant factors influencing the entire Combustion process is the mixing between a swirling angular jet (Primary Air) and the non-swirling inner jet (fuel). To study this fundamental flow, the chamber had to be designed in such a manner that the combustion process to sustain itself in a continuous manner and the temperature of the products is sufficiently below the maximum working temperature in the turbine. This study is used to develop the effective combustion with low unburned combustion products by adopting the concept of high swirl flow and motility of holes in the secondary chamber. The proper selection of a swirler is needed to reduce emission which can be concluded from the emission of Nox and CO2. The capture of CO2 is necessary to mitigate CO2 emissions from natural gas. Thus the suppression of unburned gases is a meaningful objective for the development of high performance combustor without affecting turbine blade temperature.

217
9999007
Preparation and in vivo Assessment of Nystatin-Loaded Solid Lipid Nanoparticles for Topical Delivery against Cutaneous Candidiasis
Abstract:

Solid lipid nanoparticles (SLNs) have gained great attention for the topical treatment of skin associated fungal infection as they facilitate the skin penetration of loaded drugs. Our work deals with the preparation of nystatin loaded solid lipid nanoparticles (NystSLNs) using the hot homogenization and ultrasonication method. The prepared NystSLNs were characterized in terms of entrapment efficiency, particle size, zeta potential, transmission electron microscopy, differential scanning calorimetry, rheological behavior and in vitro drug release. A stability study for 6 months was performed. A microbiological study was conducted in male rats infected with Candida albicans, by counting the colonies and examining the histopathological changes induced on the skin of infected rats. The results showed that SLNs dispersions are spherical in shape with particle size ranging from 83.26±11.33 to 955.04±1.09 nm. The entrapment efficiencies are ranging from 19.73±1.21 to 72.46±0.66% with zeta potential ranging from -18.9 to -38.8 mV and shear-thinning rheological Behavior. The stability studies done for 6 months showed that nystatin (Nyst) is a good candidate for topical SLN formulations. A least number of colony forming unit/ ml (cfu/ml) was recorded for the selected NystSLN compared to the drug solution and the commercial Nystatin® cream present in the market. It can be fulfilled from this work that SLNs provide a good skin targeting effect and may represent promising carrier for topical delivery of Nyst offering the sustained release and maintaining the localized effect, resulting in an effective treatment of cutaneous fungal infection.

216
9999000
A User Study on the Adoption of Context-Aware Destination Mobile Applications
Abstract:

With the advances in information and communications technology, mobile context-aware applications have become powerful marketing tools. In Apple online store, there are numerous mobile applications (APPs) developed for destination tour. This study investigated the determinants of adoption of context-aware APPs for destination tour services. A model is proposed based on Technology Acceptance Model and privacy concern theory. The model was empirically tested based on a sample of 259 users of a tourism APP published by Kaohsiung Tourism Bureau, Taiwan. The results showed that the fitness of the model is well and, among all the factors, the perceived usefulness and perceived ease of use have the most significant influences on the intention to adopt context-aware destination APPs. Finally, contrary to the findings of previous literature, the effect of privacy concern on the adoption intention of context-aware APP is insignificant.

215
9998999
The Gasification of Fructose in Supercritical Water
Abstract:

Biomass is renewable and sustainable. As an energy source, it will not release extra carbon dioxide into the atmosphere. Hence, tremendous efforts have been made to develop technologies capable of transforming biomass into suitable forms of bio-fuel. One of the viable technologies is gasifying biomass in supercritical water (SCW), a green medium for reactions. While previous studies overwhelmingly selected glucose as a model compound for biomass, the present study adopted fructose for the sake of comparison. The gasification of fructose in SCW was investigated experimentally to evaluate the applicability of supercritical water processes to biomass gasification. Experiments were conducted with an autoclave reactor. Gaseous product mainly consists of H2, CO, CO2, CH4 and C2H6. The effect of two major operating parameters, the reaction temperature (673-873 K) and the dosage of oxidizing agent (0-0.5 stoichiometric oxygen), on the product gas composition, yield and heating value was also examined, with the reaction pressure fixed at 25 MPa.

214
9998998
DFT Study of Half Sandwich of Vanadium (IV) Cyclopentadienyl Complexes
Abstract:

A novel new vanadium (IV) complexes incorporating the chelating diamido cyclopentadienyl {ArN(CH2)3NAr)}2-((ηn-Cp)Cp)} (Ar = 2,6-Pri2C6H3)(Cp = C5H5 and n = 1,2,3,4 and 5) have been studied with calculation of the properties of species involved in various of cyclopentadienyl reaction. These were carried out under investigation of density functional theory (DFT) calculation, and comparing together. Other methods, explicitly including electron correlation, are necessary for more accurate calculations; MB3LYP (Becke) (Lee–Yang–Parr) level of theory often being used to obtain more exact results. These complexes were estimated of electronic energy for molecular system, because it accounts for all electron correlation interactions.

The optimised of [V(ArN(CH2)3NAr)2Cl(η5-Cp)] (Ar = 2,6-Pri2C6H3 and Cp= C5H5) was found to be thermally more stable than others of vanadium cyclopentadienyl. In the meantime the complex [V(ArN(CH2)3NAr)2Cl(η1-Cp)] (Ar = 2,6-Pri2C6H3 and Cp= C5H5) which is showed a low thermal stability in case of the just one carbon of cyclopentadienyl can be insertion with vanadium metal centre. By using Dewar-Chatt-Duncanson model, as a basis of the molecular orbital (MO) analysis and showed the highest occupied molecular orbital (HOMO) and lowest occupied molecular orbital LUMO.

213
9998997
Zero Carbon & Low Energy Housing; Comparative Analysis of Two Persian Vernacular Architectural Solutions to Increase Energy Efficiency
Authors:
Abstract:

In order to respond the human needs, all regional, social, and economical factors are available to gain residents’ comfort and ideal architecture. There is no doubt the thermal comfort has to satisfy people not only for daily and physical activities but also creating pleasant area for mental activities and relaxing. It costs energy and increases greenhouse gas emissions.

Reducing energy use in buildings is a critical component of meeting carbon reduction commitments. Hence housing design represents a major opportunity to cut energy use and CO2 emissions.

In terms of energy efficiency, it is vital to propose and research modern design methods for buildings however vernacular architecture techniques are proven empirical existing practices which have to be considered. This research tries to compare two architectural solution were proposed by Persian vernacular architecture, to achieve energy efficiency in hot areas.

The aim of this research is to analyze two forms of traditional Persian architecture in different locations in order to develop a systematic research and sustainable technologies on adaptation to contemporary living standards.

212
9998996
A CFD Analysis of Hydraulic Characteristics of the Rod Bundles in the BREST-OD-300 Wire-Spaced Fuel Assemblies
Abstract:

This paper presents the findings from a numerical simulation of the flow in 37-rod fuel assembly models spaced by a double-wire trapezoidal wrapping as applied to the BREST-OD-300 experimental nuclear reactor. Data on a high static pressure distribution within the models, and equations for determining the fuel bundle flow friction factors have been obtained. Recommendations are provided on using the closing turbulence models available in the ANSYS Fluent. A comparative analysis has been performed against the existing empirical equations for determining the flow friction factors. The calculated and experimental data fit has been shown.

An analysis into the experimental data and results of the numerical simulation of the BREST-OD-300 fuel rod assembly hydrodynamic performance are presented.

211
9998995
Real-Time Measurement Approach for Tracking the ΔV10 Estimate Value of DC EAF
Abstract:

This investigation develops a revisable method for estimating the estimate value of equivalent 10 Hz voltage flicker (DV10) of a DC Electric Arc Furnace (EAF). This study also discusses three 161kV DC EAFs by field measurement, with those results indicating that the estimated DV10 value is significantly smaller than the survey value. The key point is that the conventional means of estimating DV10 is inappropriate. There is a main cause as the assumed Qmax is too small.

Although DC EAF is regularly operated in a constant MVA mode, the reactive power variation in the Main Transformer (MT) is more significant than that in the Furnace Transformer (FT). A substantial difference exists between estimated maximum reactive power fluctuation (DQmax) and the survey value from actual DC EAF operations. However, this study proposes a revisable method that can obtain a more accurate DV10 estimate than the conventional method.

210
9998994
Application of IED to Condition Based Maintenance of Medium Voltage GCB/VCB
Abstract:

Time base maintenance (TBM) is conventionally applied by the power utilities to maintain circuit breakers (CBs), transformers, bus bars and cables, which may result in under maintenance or over maintenance. As information and communication technology (ICT) industry develops, the maintenance policies of many power utilities have gradually changed from TBM to condition base maintenance (CBM) to improve system operating efficiency, operation cost and power supply reliability. This paper discusses the feasibility of using intelligent electronic devices (IEDs) to construct a CB CBM management platform. CBs in power substations can be monitored using IEDs with additional logic configuration and wire connections. The CB monitoring data can be sent through intranet to a control center and be analyzed and integrated by the Elipse Power Studio software. Finally, a human-machine interface (HMI) of supervisory control and data acquisition (SCADA) system can be designed to construct a CBM management platform to provide maintenance decision information for the maintenance personnel, management personnel and CB manufacturers.

209
9998958
Potentials of Raphia hookeri Wine in Livelihood Sustenance among Rural and Urban Populations in Nigeria
Abstract:

Raphia wine is an important forest product with cultural significance besides its use as medicine and food in southern Nigeria. This work aims to evaluate the profitability of Raphia wine production and marketing in Sapele Local Government Area, Nigeria. Four communities (Sapele, Ogiede, Okuoke and Elume) were randomly selected for data collection via questionnaires among producers and marketers. A total of 50 producers and 34 marketers were randomly selected for interview. Data was analyzed using descriptive statistics, profit margin, multiple regression and rate of returns on investment (RORI). Annual average profit was highest in Okuoke (Producers – N90, 000.00, Marketers - N70, 000.00) and least in Sapele (Producers N50, 000.00, Marketers – N45, 000.00). Calculated RORI for marketers were Elume (40.0%), Okuoke (25.0%), Ogiede (33.3%) and Sapele (50.0%). Regression results showed that location has significant effects (0.000, ρ ≤ 0.05) on profit margins. Male (58.8%) and female (41.2%) invest in Raphia wine marketing, while males (100.0%) dominate production. Results showed that Raphia wine has potentials to generate household income, enhance food security and improve quality of life in rural, semi-urban and urban communities. Improved marketing channels, storage facilities and credit facilities via cooperative groups are recommended for producers and marketers by concerned agencies.

208
9998947
Two Day Ahead Short Term Load Forecasting Neural Network Based
Abstract:

This paper presents an Artificial Neural Network based approach for short-term load forecasting and exactly for two days ahead. Two seasons have been discussed for Iraqi power system, namely summer and winter; the hourly load demand is the most important input variables for ANN based load forecasting. The recorded daily load profile with a lead time of 1-48 hours for July and December of the year 2012 was obtained from the operation and control center that belongs to the Ministry of Iraqi electricity.

The results of the comparison show that the neural network gives a good prediction for the load forecasting and for two days ahead.

207
9998944
The Impact of Training Method on Programming Learning Performance
Abstract:

Although several factors that affect learning to program have been identified over the years, there continues to be no indication of any consensus in understanding why some students learn to program easily and quickly while others have difficulty. Seldom have researchers considered the problem of how to help the students enhance the programming learning outcome. The research had been conducted at a high school in Taiwan. Students participating in the study consist of 330 tenth grade students enrolled in the Basic Computer Concepts course with the same instructor. Two types of training methods-instruction-oriented and exploration-oriented were conducted. The result of this research shows that the instruction-oriented training method has better learning performance than exploration-oriented training method.

206
9998946
Perspective and Challenge of Tidal Power in Bangladesh
Abstract:

Tidal power can play a vital role in integrating as new source of renewable energy to the off-grid power connection in isolated areas, namely Sandwip, in Bangladesh. It can reduce the present energy crisis and improve the social, environmental and economic perspective of Bangladesh. Tidal energy is becoming popular around the world due to its own facilities. The development of any country largely depends on energy sector improvement. Lack of energy sector is because of hampering progress of any country development, and the energy sector will be stable by only depend on sustainable energy sources. Renewable energy having environmental friendly is the only sustainable solution of secure energy system. Bangladesh has a huge potential of tidal power at different locations, but effective measures on this issue have not been considered sincerely. This paper summarizes the current energy scenario, and Bangladesh can produce power approximately 53.19 MW across the country to reduce the growing energy demand utilizing tidal energy as well as it is shown that Sandwip is highly potential place to produce tidal power, which is estimated approximately 16.49 MW by investing only US $10.37 million. Besides this, cost management for tidal power plant has been also discussed.

205
9998943
Detection ofTensile Forces in Cable-Stayed Structures Using the Advanced Hybrid Micro-Genetic Algorithm
Authors:
Abstract:

This study deals with an advanced numerical techniques to detect tensile forces in cable-stayed structures. The proposed method allows us not only to avoid the trap of minimum at initial searching stage but also to find their final solutions in better numerical efficiency. The validity of the technique is numerically verified using a set of dynamic data obtained from a simulation of the cable model modeled using the finite element method. The results indicate that the proposed method is computationally efficient in characterizing the tensile force variation for cable-stayed structures.

204
9998939
Sustainability as a Criterion in the Reconstruction of Libya’s Public Transport Infrastructure
Abstract:

Amongst the many priorities facing Libya following the 2011 uprising is the provision of a transport infrastructure that will meet the nation’s needs and not undermine its prospects for economic prosperity as with many developing economies non-technical issues such as management, planning and financing are the major barriers to the efficient and effective provision of transport infrastructure. This is particularly true in the case of the effective incorporation of sustainability criteria, and the research upon which this paper is based involves the examination of alternative ways of approaching this problem. It is probably fair to say that criteria that relate to sustainability have not, historically, featured strongly in Libya’s approach to the development of its transport infrastructure. However, the current reappraisal of how best to redevelop the country’s transport infrastructure that has been afforded by recent events may offer the opportunity to alter this. The research examines recent case studies from a number of countries to explore ways in which sustainability has been included as a criterion for planning and procurement decisions. There will also be an in-depth investigation into the Libyan planning and legislative context to examine the feasibility of the introduction of such sustainability criteria into the process of planning and procurement of Libya’s transport infrastructure.

203
9998938
Genetic Polymorphisms and Haplotype Structure of the Organic Cation Transporter 1 Gene in the Zulu Population of South Africa
Abstract:

Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.

202
9998937
The Development of Speaking Using Folk Tales Based On Performance Activities for Early Childhood Student
Abstract:

The research on the development of speaking using folk tales based on performance activities aimed to (1) study the development of speaking skill for early- childhood students, and (2) evaluate the development of speaking skill before and after speaking activities. Ten students of Kindergarten level 2, who have enrolled in the subject of the research for speaking development of semester 2 in 2013 were purposively selected as the research cohort. The research tools were lesson plans for speaking activities and pre-post test for speaking development that were approved as content validity and reliability (IOC=.66-1.00,α=0.967). The research found that the development of speaking skill of the research samples before using performance activities on folk tales in developing speaking skill was in the normal high level. Additionally, the results appeared that the preschoolers after applying speaking skill on performance activities also imaginatively created their speaking skill.

201
9998936
Farmers’ Awareness and Behavior of Chemical Pesticide Uses in Suan Luang Sub-District Municipality, Ampawa, Samut Songkram, Thailand
Abstract:

This paper is aimed to investigate farmers’ level of awareness and behavior of chemical pesticide uses, by using a case study of Suan Luang Sub- District Municipality, Ampawa, Samut Songkram Province. Questionnaire was employed in this study with the farmers from 46 households to explore their level of awareness in chemical pesticide uses, while interview and observation were adopted in exploring their behavior of chemical pesticide uses. The findings reflected the farmers’ high level of awareness in chemical pesticide uses in the hazardous effects of the chemical to human and environmental health, while their behavior of chemical pesticide uses explained their awareness paid to the right way of using pesticides, for instance reading the direction on the label, keeping children and animals away from the area of pesticide mixing, covering body with clothes and wearing hat and mask, no smoking, eating or drinking during pesticide spray or standing in windward direction.

200
9998932
Design and Implementation of a Control System for a Walking Robot with Color Sensing and Line Following Using PIC and ATMEL Microcontrollers
Abstract:

The aim of this research is to design and implement line-tracking mobile robot. The robot must follow a line drawn on the floor with different color, avoids hitting moving object like another moving robot or walking people and achieves color sensing. The control system reacts by controlling each of the motors to keep the tracking sensor over the middle of the line. Proximity sensors used to avoid hitting moving objects that may pass in front of the robot. The programs have been written using micro c instructions, then converted into PIC16F887 ATmega48/88/168 microcontrollers counterparts. Practical simulations show that the walking robot accurately achieves line following action and exactly recognizes the colors and avoids any obstacle in front of it.

199
9998920
A Survey of IMRT and VMAT in UK
Authors:
Abstract:

Purpose: This E-survey was carried out to facilitate the implementation and Education of VMAT (Volumetric Modulated Arc Therapy) in Radiotherapy-RT departments and reasons for not using IMRT (Intensity Modulated Radiotherapy). VMAT Skills in demand were also identified. Method: E-Survey was distributed to NHS hospitals across UK by email. Thirty NHS and related centres in England, 21 in Scotland, 3 in Ireland and 1 in Wales were contacted. This Survey was intended for those working in RT and Medical Physics and who were responsible for Treatment Planning and training. Results: This E-survey have indicated pathways adopted by staff to acquire VMAT skills, strategies to efficiently implement VMAT in RT departments and for obtaining VMAT Education. Conclusion: Despite poor survey response this survey has managed to highlight requirements for education and implementation of VMAT that are also applicable to IMRT. Other RT centres in world can also find these results useful.

198
9998919
Localization of Mobile Robots with Omnidirectional Cameras
Abstract:

Localization of mobile robots are important tasks for developing autonomous mobile robots. This paper proposes a method to estimate positions of a mobile robot using a omnidirectional camera on the robot. Landmarks for points of references are set up on a field where the robot works. The omnidirectional camera which can obtain 360 [deg] around images takes photographs of these landmarks. The positions of the robots are estimated from directions of these landmarks that are extracted from the images by image processing. This method can obtain the robot positions without accumulative position errors. Accuracy of the estimated robot positions by the proposed method are evaluated through some experiments. The results show that it can obtain the positions with small standard deviations. Therefore the method has possibilities of more accurate localization by tuning of appropriate offset parameters.

197
9998918
Forecasting Models for Steel Demand Uncertainty Using Bayesian Methods
Abstract:

 A forecasting model for steel demand uncertainty in Thailand is proposed. It consists of trend, autocorrelation, and outliers in a hierarchical Bayesian frame work. The proposed model uses a cumulative Weibull distribution function, latent first-order autocorrelation, and binary selection, to account for trend, time-varying autocorrelation, and outliers, respectively. The Gibbs sampling Markov Chain Monte Carlo (MCMC) is used for parameter estimation. The proposed model is applied to steel demand index data in Thailand. The root mean square error (RMSE), mean absolute percentage error (MAPE), and mean absolute error (MAE) criteria are used for model comparison. The study reveals that the proposed model is more appropriate than the exponential smoothing method.

196
9998917
Risk Factors for Defective Autoparts Products Using Bayesian Method in Poisson Generalized Linear Mixed Model
Abstract:

This research investigates risk factors for defective products in autoparts factories. Under a Bayesian framework, a generalized linear mixed model (GLMM) in which the dependent variable, the number of defective products, has a Poisson distribution is adopted. Its performance is compared with the Poisson GLM under a Bayesian framework. The factors considered are production process, machines, and workers. The products coded RT50 are observed. The study found that the Poisson GLMM is more appropriate than the Poisson GLM. For the production Process factor, the highest risk of producing defective products is Process 1, for the Machine factor, the highest risk is Machine 5, and for the Worker factor, the highest risk is Worker 6.

195
9998916
Physical, Textural and Sensory Properties of Noodles Supplemented with Tilapia Bone Flour (Tilapia nilotica)
Abstract:

Fishbone of Nile Tilapia (Tilapia nilotica), waste from the frozen Nile Tilapia fillet factory, is one of calcium sources. In order to increase fish bone powder value, this study aimed to investigate the effect of Tilapia bone flour (TBF) addition (5, 10, 15% by flour weight) on cooking quality, texture and sensory attributes of noodles. The results indicated that tensile strength, color value (a*) and water absorption of noodles significantly decreased (p£0.05) as the levels of TBF increased from 0-15%. While cooking loss, cooking time and color values (L* and b*) of noodles significantly increased (p£0.05). Sensory evaluation indicated that noodles with 5% TBF received the highest overall acceptability score.

194
9998915
Opto-Mechanical Characterization of Aspheric Lenses from the Hybrid Method
Abstract:

Aspheric optical components are an alternative to the use of conventional lenses in the implementation of imaging systems for the visible range. Spherical lenses are capable of producing aberrations. Therefore, they are not able to focus all the light into a single point. Instead, aspherical lenses correct aberrations and provide better resolution even with compact lenses incorporating a small number of lenses.

Metrology of these components is very difficult especially when the resolution requirements increase and insufficient or complexity of conventional tools requires the development of specific approaches to characterization.

This work is part of the problem existed because the objectives are the study and comparison of different methods used to measure surface rays hybrid aspherical lenses.

193
9998914
Experimental and Theoretical Study of Melt Viscosity in Injection Process
Abstract:

The state of melt viscosity in injection process is significantly influenced by the setting parameters due to that the shear rate of injection process is higher than other processes. How to determine plastic melt viscosity during injection process is important to understand the influence of setting parameters on the melt viscosity. An apparatus named as pressure sensor bushing (PSB) module that is used to evaluate the melt viscosity during injection process is developed in this work. The formulations to coupling melt viscosity with fill time and injection pressure are derived and then the melt viscosity is determined. A test mold is prepared to evaluate the accuracy on viscosity calculations between the PSB module and the conventional approaches. The influence of melt viscosity on the tensile strength of molded part is proposed to study the consistency of injection quality.

192
9998913
Effect on Physicochemical and Sensory Attributes of Bread Substituted with Different Levels of Matured Soursop (Anona muricata) Flour
Abstract:

Soursop (Anona muricata) is one of the underutilized tropical fruits containing nutrients, particularly dietary fibre and antioxidant properties that are beneficial to human health. This objective of this study is to investigate the feasibility of matured soursop pulp flour (SPF) to be substituted with high-protein wheat flour in bread. Bread formulation was substituted with different levels of SPF (0%, 5%, 10% and 15%). The effect on physicochemical properties and sensory attributes were evaluated. Higher substitution level of SPF resulted in significantly higher (p<0.05) fibre, protein and ash content, while fat and carbohydrate content reduced significantly (p<0.05). FESEM showed that the bread crumb surface of control and 5% SPF appeared to distribute evenly and coalesced by thin gluten film. However, higher SPF substitution level in bread formulation exhibited a deleterious effect by formation of discontinuous gluten network. For texture profile analysis, 5% SPF bread resulted in the lowest value of hardness. The score of sensory evaluation showed that 5% SPF bread received good acceptability and is comparable with control bread.

191
9998912
Interfacial Layer Effect on Novel p-Ni1-xO:Li/n-Si Heterojunction Solar Cells
Abstract:

This study fabricates p-type Ni1−xO:Li/n-Si heterojunction solar cells (P+/n HJSCs) by using radio frequency (RF) magnetron sputtering and investigates the effect of substrate temperature on photovoltaic cell properties. Grazing incidence x-ray diffraction, four point probe, and ultraviolet-visible-near infrared discover the optoelectrical properties of p-Ni1-xO thin films. The results show that p-Ni1-xO thin films deposited at 300 oC has the highest grain size (22.4 nm), average visible transmittance (~42%), and electrical resistivity (2.7 Ωcm). However, the conversion efficiency of cell is shown only 2.33% which is lower than the cell (3.39%) fabricated at room temperature. This result can be mainly attributed to interfacial layer thickness (SiOx) reduces from 2.35 nm to 1.70 nm, as verified by high-resolution transmission electron microscopy.

190
9998911
Optimal Design of Two-Channel Recursive Parallelogram Quadrature Mirror Filter Banks
Abstract:

This paper deals with the optimal design of two-channel recursive parallelogram quadrature mirror filter (PQMF) banks. The analysis and synthesis filters of the PQMF bank are composed of two-dimensional (2-D) recursive digital all-pass filters (DAFs) with nonsymmetric half-plane (NSHP) support region. The design problem can be facilitated by using the 2-D doubly complementary half-band (DC-HB) property possessed by the analysis and synthesis filters. For finding the coefficients of the 2-D recursive NSHP DAFs, we appropriately formulate the design problem to result in an optimization problem that can be solved by using a weighted least-squares (WLS) algorithm in the minimax (L∞) optimal sense. The designed 2-D recursive PQMF bank achieves perfect magnitude response and possesses satisfactory phase response without requiring extra phase equalizer. Simulation results are also provided for illustration and comparison.

189
9998910
Grid Independence Study of Flow Past a Square Cylinder Using the Multi-Relaxation-Time Lattice Boltzmann Method
Abstract:

Numerical calculations of flow around a square cylinder are presented using the multi-relaxation-time lattice Boltzmann method at Reynolds number 150. The effects of upstream locations, downstream locations and blockage are investigated systematically. A detail analysis are given in terms of time-trace analysis of drag and lift coefficients, power spectra analysis of lift coefficient, vorticity contours visualizations and phase diagrams. A number of physical quantities mean drag coefficient, drag coefficient, Strouhal number and root-mean-square values of drag and lift coefficients are calculated and compared with the well resolved experimental data and numerical results available in open literature. The results had shown that the upstream, downstream and height of the computational domain are at least 7.5, 37.5 and 12 diameters of the cylinder, respectively.

188
9998901
Serological IgG Testing to Diagnose Alimentary Induced Diseases and Monitoring Efficacy of an Individual Defined Diet in Dogs
Abstract:

Background. Food-related allergies and intolerances are frequently occurring in dogs. Diagnosis and monitoring according ‘Golden Standard’ of elimination efficiency is, however, time consuming, expensive, and requires expert clinical setting. In order to facilitate rapid and robust, quantitative testing of intolerance, and determining the individual offending foods, a serological test is implicated for Alimentary Induced Diseases and manifestations. Method. As we developed Medisynx IgG Human Screening Test ELISA before and the dog’ immune system is most similar to humans, we were able to develop Medisynx IgG Dog Screening Test ELISA as well. In this randomized, double-blind, split-sample, retro perspective study 47 dogs suffering from Canine Atopic Dermatitis (CAD) and several secondary induced reactions were included to participate in serological Medisynx IgG Dog Screening Test ELISA (within < 0,02 % SD). Results were expressed as titers relative to the standard OD readings to diagnose alimentary induced diseases and monitoring efficacy of an individual eliminating diet in dogs. Split sample analysis was performed by independently sending 2 times 3 ml serum under two unique codes. Results. The veterinarian monitored these dogs to check dog’ results at least at 3, 7, 21, 49, 70 days and after period of 6 and 12 months on an individual negative diet and a positive challenge (retrospectively) at 6 months. Data of each dog were recorded in a screening form and reported that a complete recovery of all clinical manifestations was observed at or less than 70 days (between 50 and 70 days) in the majority of dogs (44 out of 47 dogs =93.6%). Conclusion. Challenge results showed a significant result of 100% in specificity as well as 100% positive predicted value. On the other hand, sensitivity was 95,7% and negative predictive value was 95,7%. In conclusion, an individual diet based on IgG ELISA in dogs provides a significant improvement of atopic dermatitis and pruritus including all other non-specific defined allergic skin reactions as erythema, itching, biting and gnawing at toes, as well as to several secondary manifestations like chronic diarrhoea, chronic constipation, otitis media, obesity, laziness or inactive behaviour, pain and muscular stiffness causing a movement disorders, excessive lacrimation, hyper behaviour, nervous behaviour and not possible to stay alone at home, anxiety, biting and aggressive behaviour and disobedience behaviour. Furthermore, we conclude that a relatively more severe systemic candidiasis, as shown by relatively higher titer (class 3 and 4 IgG reactions to Candida albicans), influence the duration of recovery from clinical manifestations in affected dogs. These findings are consistent with our preliminary human clinical studies.

187
9998865
Measuring Government’s Performance (Services) Oman Service Maturity Model (OSMM)
Abstract:

To measure or asses any government’s efficiency we need to measure the performance of this government in regards to the quality of the service it provides. Using a technological platform in service provision became a trend and a public demand. It is also a public need to make sure these services are aligned to values and to the whole government’s strategy, vision and goals as well. Providing services using technology tools and channels can enhance the internal business process and also help establish many essential values to government services like transparency and excellence, since in order to establish e-services many standards and policies must be put in place to enable the handing over of decision making to a mature system oriented mechanism. There was no doubt that the Sultanate of Oman wanted to enhance its services and move it towards automation and establishes a smart government as well as links its services to life events. Measuring government efficiency is very essential in achieving social security and economic growth, since it can provide a clear dashboard of all projects and improvements. Based on this data we can improve the strategies and align the country goals to them.

186
9998868
Research Analysis in Eclectic Theory (Kaboudan and Sfandiar)
Abstract:

Present research investigates eclecticism in Iranian theatre on the basis of eclectic theory. Eclectic theatre is a new theory in postmodernism. The theory appeared during 60th – 70th century in some theatres such as “Conference of the Birds”. Special theatrical forms have been developed in many geographical- cultural areas of the world and are indigenous to that area. These forms, as compared with original forms, are considered to be traditional while being comprehensive, the form is considered to be national. Kaboudan and Sfandiar theatre has been influenced by elements of traditional form of Iran.

185
9998900
Separation Characteristics of Dissolved Gases from Water Using a Polypropylene Hollow Fiber Membrane Module with High Surface Area
Abstract:

A polypropylene hollow fiber membrane module is used for separating dissolved gases which contain dissolved oxygen from water. These dissolved gases can be used for underwater breathing. To be used for a human, the minimum amount of oxygen is essential. To increase separation of dissolved gases, much water and high surface area of hollow fibers are requested. For efficient separation system, performance of single membrane module with high surface area needs to be investigated.

In this study, we set up experimental devices for analyzing separation characteristics of dissolved gases including oxygen from water using a polypropylene hollow fiber membrane module. Separation of dissolved gases from water is investigated with variations of water flow rates. Composition of dissolved gases is also measured using GC. These results expect to be used in developing the portable separation system.

184
9998899
Applying Wavelet Transform to Ferroresonance Detection and Protection
Abstract:

Non-synchronous breakage or line failure in power systems with light or no loads can lead to core saturation in transformers or potential transformers. This can cause component and capacitance matching resulting in the formation of resonant circuits, which trigger ferroresonance. This study employed a wavelet transform for the detection of ferroresonance. Simulation results demonstrate the efficacy of the proposed method.

183
9998898
Capacity Building of Extension Agents for Sustainable Dissemination of Agricultural Information and Technologies in Developing Countries
Abstract:

Farmers are in need of regular and relevant information relating to new technologies. Production of extension materials has been found to be useful in facilitating the process. Extension materials help to provide information to reach large numbers of farmers quickly and economically. However, as good as extension materials are, previous materials produced are not used by farmers. The reasons for this include lack of involvement of farmers in the production of the extension materials, most of the extension materials are not relevant to the farmers’ environments, the agricultural extension agents lack capacity to prepare the materials, and many extension agents lack commitment. These problems led to this innovative capacity building of extension agents. This innovative approach involves five stages. The first stage is the diagnostic survey of farmers’ environment to collect useful information. The second stage is the development and production of draft extension materials. The third stage is the field testing and evaluation of draft materials by the same famers that were involved at the diagnostic stage. The fourth stage is the revision of the draft extension materials by incorporating suggestions from farmers. The fifth stage is the action plans. This process improves the capacity of agricultural extension agents in the preparation of extension materials and also promotes engagement of farmers and beneficiaries in the process. The process also makes farmers assume some level of ownership of the exercise and the extension materials.

182
9998897
Corporate Social Responsibility in an Experimental Market
Abstract:

We present results from experimental price-setting oligopolies in which green firms undertake different levels of energy-saving investments motivated by public subsidies and demand-side advantages. We find that consumers reveal higher willingness to pay for greener sellers’ products. This observation in conjunction to the fact that greener sellers set higher prices is compatible with the use and interpretation of energy-saving behaviour as a differentiation strategy. However, sellers do not exploit the resulting advantage through sufficiently high price-cost margins, because they seem trapped into “run to stay still” competition. Regarding the use of public subsidies to energy-saving sellers we uncover an undesirable crowding-out effect of consumers’ intrinsic tendency to support green manufacturers. Namely, consumers may be less willing to support a green seller whose energy-saving strategy entails a direct financial benefit. Finally, we disentangle two alternative motivations for consumer’s attractions to pro-social firms; first, the self-interested recognition of the firm’s contribution to the public and private welfare and, second, the need to compensate a firm for the cost entailed in each pro-social action. Our results show the prevalence of the former over the latter.

181
9998896
Parameters Affecting the Elasto-Plastic Behavior of Outrigger Braced Walls to Earthquakes
Abstract:

Outrigger-braced wall systems are commonly used to provide high rise buildings with the required lateral stiffness for wind and earthquake resistance. The existence of outriggers adds to the stiffness and strength of walls as reported by several studies. The effects of different parameters on the elasto-plastic dynamic behavior of outrigger-braced wall systems to earthquakes are investigated in this study. Parameters investigated include outrigger stiffness, concrete strength, and reinforcement arrangement as the main design parameters in wall design. In addition to being significantly affect the wall behavior, such parameters may lead to the change of failure mode and the delay of crack propagation and consequently failure as the wall is excited by earthquakes. Bi-linear stress-strain relation for concrete with limited tensile strength and truss members with bi-linear stress-strain relation for reinforcement were used in the finite element analysis of the problem. The famous earthquake record, El-Centro, 1940 is used in the study. Emphasize was given to the lateral drift, normal stresses and crack pattern as behavior controlling determinants. Results indicated significant effect of the studied parameters such that stiffer outrigger, higher grade concrete and concentrating the reinforcement at wall edges enhance the behavior of the system. Concrete stresses and cracking behavior are too much enhanced while less drift improvements are observed.

180
9998895
Optimal Simultaneous Sizing and Siting of DGs and Smart Meters Considering Voltage Profile Improvement in Active Distribution Networks
Abstract:

This paper investigates the effect of simultaneous placement of DGs and smart meters (SMs), on voltage profile improvement in active distribution networks (ADNs). A substantial center of attention has recently been on responsive loads initiated in power system problem studies such as distributed generations (DGs). Existence of responsive loads in active distribution networks (ADNs) would have undeniable effect on sizing and siting of DGs. For this reason, an optimal framework is proposed for sizing and siting of DGs and SMs in ADNs. SMs are taken into consideration for the sake of successful implementing of demand response programs (DRPs) such as direct load control (DLC) with end-side consumers. Looking for voltage profile improvement, the optimization procedure is solved by genetic algorithm (GA) and tested on IEEE 33-bus distribution test system. Different scenarios with variations in the number of DG units, individual or simultaneous placing of DGs and SMs, and adaptive power factor (APF) mode for DGs to support reactive power have been established. The obtained results confirm the significant effect of DRPs and APF mode in determining the optimal size and site of DGs to be connected in ADN resulting to the improvement of voltage profile as well.

179
9998894
Development and Structural Performance Evaluation on Slit Circular Shear Panel Damper
Abstract:

There are several types of metal-based devices conceived as dampers for the seismic energy absorber whereby damages to the major structural components could be minimized for both new and existing structures. This paper aimed to develop and evaluate structural performance of slit circular shear panel damper for passive seismic energy protection by inelastic deformation. Structural evaluation was done using commercially available nonlinear FE simulation program. The main parameters considered are: diameter-to-thickness (D/t) ratio and slit length-to-width ratio (l/w). Depending on these parameters three different buckling mode and hysteretic behavior was found: yielding prior to buckling without strength degradation, yielding prior to buckling with strength degradation and yielding with buckling and strength degradation which forms pinching at initial displacement. The susceptible location at which the possible crack is initiated is also identified for selected specimens using rupture index.

178
9998887
Online Metacognitive Reading Strategies Use by Postgraduate Libyan EFL Students
Abstract:

With the increasing popularity of the Internet, online reading has become an essential source for EFL readers. Using strategies to comprehend information on online reading texts play a crucial role in students’ academic success. Metacognitive reading strategies are effective factors that enhance EFL learners reading comprehension. This study aimed at exploring the use of online metacognitive reading strategies by postgraduate Libyan EFL students. Quantitative data was collected using the Survey of Online Reading Strategies (OSORS). The findings revealed that the participants were moderate users of metacognitive online reading strategies. Problem solving strategies were the most frequently reported used strategies, while support reading strategies were the least. The five most and least frequently reported strategies were identified. Based on the findings, some future research recommendations were presented.

177
9998886
Enhanced Weighted Centroid Localization Algorithm for Indoor Environments
Abstract:

Lately, with the increasing number of location-based applications, demand for highly accurate and reliable indoor localization became urgent. This is a challenging problem, due to the measurement variance which is the consequence of various factors like obstacles, equipment properties and environmental changes in complex nature of indoor environments. In this paper we propose low-cost custom-setup infrastructure solution and localization algorithm based on the Weighted Centroid Localization (WCL) method. Localization accuracy is increased by several enhancements: calibration of RSSI values gained from wireless nodes, repetitive measurements of RSSI to exclude deviating values from the position estimation, and by considering orientation of the device according to the wireless nodes. We conducted several experiments to evaluate the proposed algorithm. High accuracy of ~1m was achieved.

176
9998885
Dynamic Behavior of Brain Tissue under Transient Loading
Abstract:

In this paper, an analytical study is made for the dynamic behavior of human brain tissue under transient loading. In this analytical model the Mooney-Rivlin constitutive law is coupled with visco-elastic constitutive equations to take into account both the nonlinear and time-dependent mechanical behavior of brain tissue. Five ordinary differential equations representing the relationships of five main parameters (radial stress, circumferential stress, radial strain, circumferential strain, and particle velocity) are obtained by using the characteristic method to transform five partial differential equations (two continuity equations, one motion equation, and two constitutive equations). Analytical expressions of the attenuation properties for spherical wave in brain tissue are analytically derived. Numerical results are obtained based on the five ordinary differential equations. The mechanical responses (particle velocity and stress) of brain are compared at different radii including 5, 6, 10, 15 and 25 mm under four different input conditions. The results illustrate that loading curves types of the particle velocity significantly influences the stress in brain tissue. The understanding of the influence by the input loading cures can be used to reduce the potentially injury to brain under head impact by designing protective structures to control the loading curves types.

175
9998884
Investigation of Adaptable Winglets for Improved UAV Control and Performance
Abstract:

An investigation of adaptable winglets for morphing aircraft control and performance is described in this paper. The concepts investigated consist of various winglet configurations fundamentally centred on a baseline swept wing. The impetus for the work was to identify and optimize winglets to enhance controllability and the aerodynamic efficiency of a small unmanned aerial vehicle. All computations were performed with Athena Vortex Lattice modelling with varying degrees of twist, swept, and dihedral angle considered. The results from this work indicate that if adaptable winglets were employed on small scale UAV’s improvements in both aircraft control and performance could be achieved.

174
9998883
A Virtual Grid Based Energy Efficient Data Gathering Scheme for Heterogeneous Sensor Networks
Abstract:

Traditional Wireless Sensor Networks (WSNs) generally use static sinks to collect data from the sensor nodes via multiple forwarding. Therefore, network suffers with some problems like long message relay time, bottle neck problem which reduces the performance of the network.

Many approaches have been proposed to prevent this problem with the help of mobile sink to collect the data from the sensor nodes, but these approaches still suffer from the buffer overflow problem due to limited memory size of sensor nodes. This paper proposes an energy efficient scheme for data gathering which overcomes the buffer overflow problem. The proposed scheme creates virtual grid structure of heterogeneous nodes. Scheme has been designed for sensor nodes having variable sensing rate. Every node finds out its buffer overflow time and on the basis of this cluster heads are elected. A controlled traversing approach is used by the proposed scheme in order to transmit data to sink. The effectiveness of the proposed scheme is verified by simulation.

173
9998882
Design of Active Power Filters for Harmonics on Power System and Reducing Harmonic Currents
Abstract:

In the last few years, harmonics have been occurred with the increasing use of nonlinear loads, and these harmonics have been an ever increasing problem for the line systems. This situation importantly affects the quality of power and gives large losses to the network. An efficient way to solve these problems is providing harmonic compensation through parallel active power filters. Many methods can be used in the control systems of the parallel active power filters which provide the compensation. These methods efficiently affect the performance of the active power filters. For this reason, the chosen control method is significant. In this study, Fourier analysis (FA) control method and synchronous reference frame (SRF) control method are discussed. These control methods are designed for both eliminate harmonics and perform reactive power compensation in MATLAB/Simulink pack program and are tested. The results have been compared for each two methods.

172
9998881
Jet-Stream Airsail: Study of the Shape and the Behavior of the Connecting Cable
Abstract:

A Jet-stream airsail concept takes advantage of aerology in order to fly without propulsion. Weather phenomena, especially jet streams, are relatively permanent high winds blowing from west to east, located at average altitudes and latitudes in both hemispheres. To continuously extract energy from the jet-stream, the system is composed of a propelled plane and a wind turbine interconnected by a cable. This work presents the aerodynamic characteristics and the behavior of the cable that links the two subsystems and transmits energy from the turbine to the aircraft. Two ways of solving this problem are explored: numerically and analytically. After obtaining the optimal shape of the cross-section of the cable, its behavior is analyzed as a 2D problem solved numerically and analytically. Finally, a 3D extension could be considered by adding lateral forces. The results of this work can be further used in the design process of the overall system: aircraft-turbine.

171
9998880
Design of an Augmented Automatic Choosing Control with Constrained Input by Lyapunov Functions Using Gradient Optimization Automatic Choosing Functions
Abstract:

In this paper a nonlinear feedback control called augmented automatic choosing control (AACC) for a class of nonlinear systems with constrained input is presented. When designed the control, a constant term which arises from linearization of a given nonlinear system is treated as a coefficient of a stable zero dynamics. Parameters of the control are suboptimally selected by maximizing the stable region in the sense of Lyapunov with the aid of a genetic algorithm. This approach is applied to a field excitation control problem of power system to demonstrate the splendidness of the AACC. Simulation results show that the new controller can improve performance remarkably well.

170
9998879
Production Planning and Scheduling and SME
Abstract:

Small and medium-sized enterprises (SME) are the backbone of central Europe’s economies and have a significant contribution to the gross domestic product. Production planning and scheduling (PPS) is still a crucial element in manufacturing industries of the 21st century even though this area of research is more than a century old. The topic of PPS is well researched especially in the context of large enterprises in the manufacturing industry. However the implementation of PPS methodologies within SME is mostly unobserved. This work analyzes how PPS is implemented in SME with the geographical focus on Switzerland and its vicinity. Based on restricted resources compared to large enterprises, SME have to face different challenges. The real problem areas of selected enterprises in regards of PPS are identified and evaluated. For the identified real-life problem areas of SME clear and detailed recommendations are created, covering concepts and best practices and the efficient usage of PPS. Furthermore the economic and entrepreneurial value for companies is lined out and why the implementation of the introduced recommendations is advised.

169
9998878
Effect of Mesh Size on the Supersonic Viscous Flow Parameters around an Axisymmetric Blunt Body
Authors:
Abstract:

The aim of this work is to analyze a viscous flow around the axisymmetric blunt body taken into account the mesh size both in the free stream and into the boundary layer. The resolution of the Navier-Stokes equations is realized by using the finite volume method to determine the flow parameters and detached shock position. The numerical technique uses the Flux Vector Splitting method of Van Leer. Here, adequate time stepping parameter, CFL coefficient and mesh size level are selected to ensure numerical convergence. The effect of the mesh size is significant on the shear stress and velocity profile. The best solution is obtained with using a very fine grid. This study enabled us to confirm that the determination of boundary layer thickness can be obtained only if the size of the mesh is lower than a certain value limits given by our calculations.

168
9998877
Structural Analysis of a Composite Wind Turbine Blade
Abstract:

The design of an optimised horizontal axis 5-meter-long wind turbine rotor blade in according with IEC 61400-2 standard is a research and development project in order to fulfil the requirements of high efficiency of torque from wind production and to optimise the structural components to the lightest and strongest way possible. For this purpose, a research study is presented here by focusing on the structural characteristics of a composite wind turbine blade via finite element modelling and analysis tools. In this work, first, the required data regarding the general geometrical parts are gathered. Then, the airfoil geometries are created at various sections along the span of the blade by using CATIA software to obtain the two surfaces, namely; the suction and the pressure side of the blade in which there is a hat shaped fibre reinforced plastic spar beam, so-called chassis starting at 0.5m from the root of the blade and extends up to 4 m and filled with a foam core. The root part connecting the blade to the main rotor differential metallic hub having twelve hollow threaded studs is then modelled. The materials are assigned as two different types of glass fabrics, polymeric foam core material and the steel-balsa wood combination for the root connection parts. The glass fabrics are applied using hand wet lay-up lamination with epoxy resin as METYX L600E10C-0, is the unidirectional continuous fibres and METYX XL800E10F having a tri-axial architecture with fibres in the 0,+45,-45 degree orientations in a ratio of 2:1:1. Divinycell H45 is used as the polymeric foam. The finite element modelling of the blade is performed via MSC PATRAN software with various meshes created on each structural part considering shell type for all surface geometries, and lumped mass were added to simulate extra adhesive locations. For the static analysis, the boundary conditions are assigned as fixed at the root through aforementioned bolts, where for dynamic analysis both fixed-free and free-free boundary conditions are made. By also taking the mesh independency into account, MSC NASTRAN is used as a solver for both analyses. The static analysis aims the tip deflection of the blade under its own weight and the dynamic analysis comprises normal mode dynamic analysis performed in order to obtain the natural frequencies and corresponding mode shapes focusing the first five in and out-of-plane bending and the torsional modes of the blade. The analyses results of this study are then used as a benchmark prior to modal testing, where the experiments over the produced wind turbine rotor blade has approved the analytical calculations.

167
9998876
Integrated Flavor Sensor Using Microbead Array
Abstract:

This research presents the design, fabrication and application of a flavor sensor for an integrated electronic tongue and electronic nose that can allow rapid characterization of multi-component mixtures in a solution. The odor gas and liquid are separated using hydrophobic porous membrane in micro fluidic channel. The sensor uses an array composed of microbeads in micromachined cavities localized on silicon wafer. Sensing occurs via colorimetric and fluorescence changes to receptors and indicator molecules that are attached to termination sites on the polymeric microbeads. As a result, the sensor array system enables simultaneous and near-real-time analyses using small samples and reagent volumes with the capacity to incorporate significant redundancies. One of the key parts of the system is a passive pump driven only by capillary force. The hydrophilic surface of the fluidic structure draws the sample into the sensor array without any moving mechanical parts. Since there is no moving mechanical component in the structure, the size of the fluidic structure can be compact and the fabrication becomes simple when compared to the device including active microfluidic components. These factors should make the proposed system inexpensive to mass-produce, portable and compatible with biomedical applications.

166
9998875
Evaluation of Hand Grip Strength and EMG Signal on Visual Reaction
Abstract:

Hand grip strength has been utilized as an indicator to evaluate the motor ability of hands, responsible for performing multiple body functions. It is, however, difficult to evaluate other factors (other than hand muscular strength) utilizing the hand grip strength only. In this study, we analyzed the motor ability of hands using EMG and the hand grip strength, simultaneously in order to evaluate concentration, muscular strength reaction time, instantaneous muscular strength change, and agility in response to visual reaction. In results, the average time (and their standard deviations) of muscular strength reaction EMG signal and hand grip strength was found to be 209.6 ± 56.2 ms and 354.3 ± 54.6 ms, respectively. In addition, the onset time which represents acceleration time to reach 90% of maximum hand grip strength, was 382.9 ± 129.9 ms.

165
9998874
Proactive Approach to Innovation Management
Abstract:

The focus of this paper is to compare common approaches for Systems of Innovation (SI) and identify proactive alternatives for driving the innovation. Proactive approaches will also consider short and medium term perspectives with developments in the field of Computer Technology and Artificial Intelligence. Concerning Computer Technology and Large Connected Information Systems, it is reasonable to predict that during current or the next century intelligence and innovation will be separated from the constraints of human driven management. After this happens, humans will be no longer driving the innovation and there is possibility that SI for new intelligent systems will set its own targets and exclude humans. Over long time scale these developments could result in scenario, which will lead to the development of larger, cross galactic (universal) proactive SI and Intelligence.

164
9998873
Competitiveness of Animation Industry: The Case of Thailand
Abstract:

The research studied and examined the competitiveness of the animation industry in Thailand. Data were collected based on articles, related reports and websites, news, research, and interviews of key persons from both public and private sectors. The diamond model was used to analyze the study. The major factor driving the Thai animation industry forward includes a quality workforce, their creativity and strong associations. However, discontinuity in government support, infrastructure, marketing, IP creation and financial constraints were factors keeping the Thai animation industry less competitive in the global market.

163
9998872
Experimental Film Class: Watbangkapom School, Samut Songkhram
Authors:
Abstract:

Experimental Film Class Project is supported by the Institute for Research and Development at Suan Sunandha Rajabhat University. This project is purported to provide academic and professional services to improve the quality standards of the community and locals in accordance with the mission of the university, which is to improve and expand knowledge for the community and to develop and transfer such knowledge and professions to the next generation. Eventually, it leads to sustainable development because the development of human resources is deemed as the key for sustainable development. Moreover, the Experimental Film Class is an integral part of the teaching of film production at Suan Sunandha International School of Art (SISA). By means of giving opportunities to students for participation in projects by sharing experience, skill and knowledge and participation in field activities, it helps students in the film production major to enhance their abilities and potentials as preparation for their readiness in the marketplace. Additionally, in this class, we provide basic film knowledge, screenwriting techniques, editing and subtitles including uploading videos on social media such as YouTube and Facebook for the participant students.

162
9998871
Computational Modeling of Combustion Wave in Nanoscale Thermite Reaction
Authors:
Abstract:

Nanoscale thermites such as the composite mixture of nano-sized aluminum and molybdenum trioxide powders possess several technical advantages such as much higher reaction rate and shorter ignition delay, when compared to the conventional energetic formulations made of micron-sized metal and oxidizer particles. In this study, the self-propagation of combustion wave in compacted pellets of nanoscale thermite composites is modeled and computationally investigated by utilizing the activation energy reduction of aluminum particles due to nanoscale particle sizes. The present computational model predicts the speed of combustion wave propagation which is good agreement with the corresponding experiments of thermite reaction. Also, several characteristics of thermite reaction in nanoscale composites are discussed including the ignition delay and combustion wave structures.

161
9998870
Improving the LDMOS Temperature Compensation Bias Circuit to Optimize Back-Off
Abstract:

The application of today's semiconductor transistors in high power UHF DVB-T linear amplifiers has evolved significantly by utilizing LDMOS technology. This fact provides engineers with the option to design a single transistor signal amplifier which enables output power and linearity that was unobtainable previously using bipolar junction transistors or later type first generation MOSFETS. The quiescent current stability in terms of thermal variations of the LDMOS guarantees a robust operation in any topology of DVB-T signal amplifiers. Otherwise, progressively uncontrolled heat dissipation enhancement on the LDMOS case can degrade the amplifier’s crucial parameters in regards to the gain, linearity and RF stability, resulting in dysfunctional operation or a total destruction of the unit. This paper presents one more sophisticated approach from the traditional biasing circuits used so far in LDMOS DVB-T amplifiers. It utilizes a microprocessor control technology, providing stability in topologies where IDQ must be perfectly accurate.

160
9998869
Finite Element Analysis of Low-Velocity Impact Damage on Stiffened Composite Panels
Abstract:

To understand the factors which affect impact damage on composite structures, particularly the effects of impact position and ribs. In this paper, a finite element model (FEM) of low-velocity impact damage on the composite structure was established via the nonlinear finite element method, combined with the user-defined materials subroutine (VUMAT) of the ABAQUS software. The structural elements chosen for the investigation comprised a series of stiffened composite panels, representative of real aircraft structure. By impacting the panels at different positions relative to the ribs, the effect of relative position of ribs was found out. Then the simulation results and the experiments data were compared. Finally, the factors which affect impact damage on the structures were discussed. The paper was helpful for the design of stiffened composite structures.

159
9998867
Using Set Up Candid Clips as Viral Marketing via New Media
Abstract:

This research’s objectives were to analyze the using of new media in the form of set up candid clip that affects the product and presenter, to study the effectiveness of using new media in the form of set up candid clip in order to increase the circulation and audience satisfaction and to use the earned information and knowledge to develop the communication for publicizing and advertising via new media. This research is qualitative research based on questionnaire from 50 random sampling representative samples and in-depth interview from experts in publicizing and advertising fields. The findings indicated the positive and negative effects to the brands’ image and presenters’ image of product named “Scotch 100” and “Snickers” that used set up candid clips via new media for publicizing and advertising in Thailand. It will be useful for fields of publicizing and advertising in the new media forms.

158
9998866
55 dB High Gain L-Band EDFA Utilizing Single Pump Source
Abstract:

In this paper, we experimentally investigate the performance of an efficient high gain triple-pass L-band Erbium-Doped Fiber (EDF) amplifier structure with a single pump source. The amplifier gain and noise figure variation with EDF pump power, input signal power and wavelengths have been investigated. The generated backward Amplified Spontaneous Emission (ASE) noise of the first amplifier stage is suppressed by using a tunable band-pass filter. The amplifier achieves a signal gain of 55 dB with low noise figure of 3.8 dB at -50 dBm input signal power. The amplifier gain shows significant improvement of 12.8 dB compared to amplifier structure without ASE suppression.

157
9998864
Protective Effect of Hesperidin against Cyclophosphamide Hepatotoxicity in Rats
Abstract:

The protective effect of hesperidin was investigated in rats exposed to liver injury induced by a single intraperitoneal injection of cyclophosphamide (CYP) at a dose of 150 mg kg-1. Hesperidin treatment (100 mg kg-1/day, orally) was applied for seven days, starting five days before CYP administration. Hesperidin significantly decreased the CYP-induced elevations of serum alanine aminotransferase, and hepatic malondialdehyde and myeloperoxidase activity, significantly prevented the depletion of hepatic glutathione peroxidase activity resulted from CYP administration. Also, hesperidin ameliorated the CYP-induced liver tissue injury observed by histopathological examination. In addition, hesperidin decreased the CYP-induced expression of inducible nitric oxide synthase, tumor necrosis factor-α, cyclooxygenase-2, Fas ligand, and caspase-9 in liver tissue. It was concluded that hesperidin may represent a potential candidate to protect against CYP-induced hepatotoxicity.

156
9998863
Science School Was Burned: A Case Study of Crisis Management in Thailand
Abstract:

This study analyzes the crisis management and image repair strategies during the crisis of Mahidol Wittayanusorn School (MWIT) library burning. The library of this school was burned by a 16-year-old-male student on June 6th, 2010. This student blamed the school that the lesson was difficult, and other students were selfish. Although no one was in the building during the fire, it had caused damage to the building, books and electronic supplies around 130 million bahts (4.4 million USD). This event aroused many discourses arguing about the education system and morality. The strategies which were used during crisis were denial, shift the blame, bolstering, minimization, and uncertainty reduction. The results of using these strategies appeared after the crisis. That was the numbers of new students, who registered for the examination to get into this school in the later years, have remained the same.

155
9998862
The Effect of Electric Field Distributions on Grains and Insect for Dielectric Heating Applications
Abstract:

This paper presents the effect of electric field distribution which is an electric field intensity analysis. Consideration of the dielectric heating of grains and insects, the rice and rice weevils are utilized for dielectric heating analysis. Furthermore, this analysis compares the effect of electric field distribution in rice and rice weevil. In this simulation, two copper plates are used to generate the electric field for dielectric heating system and put the rice materials between the copper plates. The simulation is classified in two cases, which are case I one rice weevil is placed in the rice and case II two rice weevils are placed at different position in the rice. Moreover, the probes are located in various different positions on plate. The power feeding on this plate is optimized by using CST EM studio program of 1000 watt electrical power at 39 MHz resonance frequency. The results of two cases are indicated that the most electric field distribution and intensity are occurred on the rice and rice weevils at the near point of the probes. Moreover, the heat is directed to the rice weevils more than the rice. When the temperature of rice and rice weevils are calculated and compared, the rice weevils has the temperature more than rice is about 41.62 Celsius degrees. These results can be applied for the dielectric heating applications to eliminate insect.

154
9998861
Lego Mindstorms as a Simulation of Robotic Systems
Abstract:

In this paper we deal with using Lego Mindstorms in simulation of robotic systems with respect to cost reduction. Lego Mindstorms kit contains broad variety of hardware components which are required to simulate, program and test the robotics systems in practice. Algorithm programming went in development environment supplied together with Lego kit as in programming language C# as well. Algorithm following the line, which we dealt with in this paper, uses theoretical findings from area of controlling circuits. PID controller has been chosen as controlling circuit whose individual components were experimentally adjusted for optimal motion of robot tracking the line. Data which are determined to process by algorithm are collected by sensors which scan the interface between black and white surfaces followed by robot. Based on discovered facts Lego Mindstorms can be considered for low-cost and capable kit to simulate real robotics systems.

153
9998860
Quality Culture Framework Proposal for Libyan Industrial Companies
Abstract:

Libyan industrial companies face many challenges in today's competitive market. Quality management culture approaches is one of these challenges which may furnish the road to the Libyan industrial companies to effectively empower their employees and improve their ability to respond to the international competition. The primary objective of this paper is to design a practical approach to guide Libyan industrial companies toward successful quality culture implementation.

152
9998859
Evaluating the Sustainability of Agricultural by Indicator that Appropriate to the Area of Ban Phaeo District, Samut Sakorn Province, Thailand
Abstract:

The objectives of the research are to study the existing agricultural patterns, and to evaluate the sustainability of agricultural on economic, social and environmental aspects. The samplings were the representatives of the agriculturist group from Ban Paew district, Samut Sakorn province by purposive sampling method of 30 households. The tools being used were interview forms together with the Rapid Rural Appraisal (RRA) and the Participation Rural Appraisal (PRA). The information collected was analyzed with the principle of Content Analysis andusing Descriptive Statistics. After that all the information gotten was analyze the sustainability on the household level and village level. The research result can be concluded as follows: The agricultural Patterns: For most of the cultivation main crop was fruit trees planted and the supplement crop was around the patch or added other plants in the trenches. There were trenches for the cultivating water. The product distribution was by selling (97.5%) and the selling to middle man was the highest number (62.5%). Evaluating the sustainability of the agricultural by the indicators which were appropriate to the area: For the agricultural sustainability on the household level it was found that only one household had sustainable, others household had conditioned sustainable. For on the village level it was found that the sustainability on the issue of agricultural knowledge training had the lowest level (Sustainability index = 31.67%). Secondary was the acknowledging about soil information (Sustainability index = 35.0), and the household labors on agriculture, net return over cash cost (Sustainability index = 55.0%) respectively. Performance percentage is 48.81 %. It was brought to the conclusion that this area did not have the agricultural sustainability.

151
9998858
A Follow–Up Study of Bachelor of Science Graduates in Applied Statistics from Suan Sunandha Rajabhat University during the 1999-2012 Academic Years
Abstract:

The purpose of this study is to follow – up the graduated students of Bachelor of Science in Applied Statistics from Suan Sunandha Rajabhat University (SSRU) during the 1999 – 2012 academic years and to provide the fundamental guideline for developing the current curriculum according to Thai Qualifications Framework for Higher Education (TQF: HEd). The sample was collected from 75 graduates by interview and online questionnaire. The content covered 5 subjects were Ethics and Moral, Knowledge, Cognitive Skills, Interpersonal Skill and Responsibility, Numerical Analysis as well as Communication and Information Technology Skills. Data were analyzed by using statistical methods as percentiles, means, standard deviation, t- tests, and F- tests. The findings showed that samples were mostly female had less than 26 years old. The majority of graduates had income in the range of 10,001-20,000 Baht and experience range were 2-5 years. In addition, overall opinions from receiving knowledge to apply to work were at agree; mean score was 3.97 and standard deviation was 0.40. In terms of, the hypothesis testing’s result indicate gender only had different opinion at a significance level of 0.05.

150
9998857
Ultra Wideband Breast Cancer Detection by Using SAR for Indication the Tumor Location
Abstract:

This paper presents breast cancer detection by observing the specific absorption rate (SAR) intensity for identification tumor location, the tumor is identified in coordinates (x,y,z) system. We examined the frequency between 4-8 GHz to look for the most appropriate frequency. Results are simulated in frequency 4-8 GHz, the model overview include normal breast with 50 mm radian, 5 mm diameter of tumor, and ultra wideband (UWB) bowtie antenna. The models are created and simulated in CST Microwave Studio. For this simulation, we changed antenna to 5 location around the breast, the tumor can be detected when an antenna is close to the tumor location, which the coordinate of maximum SAR is approximated the tumor location. For reliable, we experiment by random tumor location to 3 position in the same size of tumor and simulation the result again by varying the antenna position in 5 position again, and it also detectable the tumor position from the antenna that nearby tumor position by maximum value of SAR, which it can be detected the tumor with precision in all frequency between 4-8 GHz.

149
9998856
Spatio-Temporal Analysis and Mapping of Malaria in Thailand
Abstract:

This paper proposes a GLMM with spatial and temporal effects for malaria data in Thailand. A Bayesian method is used for parameter estimation via Gibbs sampling MCMC. A conditional autoregressive (CAR) model is assumed to present the spatial effects. The temporal correlation is presented through the covariance matrix of the random effects. The malaria quarterly data have been extracted from the Bureau of Epidemiology, Ministry of Public Health of Thailand. The factors considered are rainfall and temperature. The result shows that rainfall and temperature are positively related to the malaria morbidity rate. The posterior means of the estimated morbidity rates are used to construct the malaria maps. The top 5 highest morbidity rates (per 100,000 population) are in Trat (Q3, 111.70), Chiang Mai (Q3, 104.70), Narathiwat (Q4, 97.69), Chiang Mai (Q2, 88.51), and Chanthaburi (Q3, 86.82). According to the DIC criterion, the proposed model has a better performance than the GLMM with spatial effects but without temporal terms.

148
9998855
Production Planning for Animal Food Industry under Demand Uncertainty
Abstract:

This research investigates the distribution of food demand for animal food and the optimum amount of that food production at minimum cost. The data consist of customer purchase orders for the food of laying hens, price of food for laying hens, cost per unit for the food inventory, cost related to food of laying hens in which the food is out of stock, such as fine, overtime, urgent purchase for material. They were collected from January, 1990 to December, 2013 from a factory in Nakhonratchasima province. The collected data are analyzed in order to explore the distribution of the monthly food demand for the laying hens and to see the rate of inventory per unit. The results are used in a stochastic linear programming model for aggregate planning in which the optimum production or minimum cost could be obtained. Programming algorithms in MATLAB and tools in Linprog software are used to get the solution. The distribution of the food demand for laying hens and the random numbers are used in the model. The study shows that the distribution of monthly food demand for laying has a normal distribution, the monthly average amount (unit: 30 kg) of production from January to December. The minimum total cost average for 12 months is Baht 62,329,181.77. Therefore, the production planning can reduce the cost by 14.64% from real cost.

147
9998854
The Sustainability of Public Debt in Taiwan
Abstract:

This study examines whether the Taiwan’s public debt is sustainable utilizing an unrestricted two-regime threshold autoregressive (TAR) model with an autoregressive unit root. The empirical results show that Taiwan’s public debt appears as a nonlinear series and is stationary in regime 1 but not in regime 2. This result implies that while Taiwan’s public debt was mostly sustainable over the 1996 to 2013 period examined in the study, it may no longer be sustainable in the most recent two years as the public debt ratio has increased cumulatively to 3.618%.

146
9998853
Hedonic Motivations for Online Shopping
Abstract:

The purpose of this study is to investigate hedonic online shopping motivations. A qualitative analysis was conducted to explore the factors influencing online hedonic shopping motivations. The results of the study indicate that traditional hedonic values, consisting of social, role, self-gratification, learning trends, pleasure of bargaining, stimulation, diversion, status, and adventure, and dimensions of flow theory, consisting of control, curiosity, enjoyment, and telepresence, exist in the online shopping environment. Two hedonic motivations unique to Internet shopping, privacy and online shopping achievement, were found. It appears that the most important hedonic value to online shoppers is having the choice to interact or not interact with others while shopping on the Internet. This study serves as a basis for the future growth of Internet marketing.

145
9998852
Constructivism Learning Management in Mathematical Analysis Courses
Authors:
Abstract:

The purposes of this research were (1) to create a learning activity for constructivism, (2) study the Mathematical Analysis courses learning achievement, and (3) study students’ attitude toward the learning activity for constructivism. The samples in this study were divided into 2 parts including 3 Mathematical Analysis courses instructors of Suan Sunandha Rajabhat University who provided basic information and attended the seminar and 17 Mathematical Analysis courses students who were studying in the academic and engaging in the learning activity for constructivism. The research instruments were lesson plans constructivism, subjective Mathematical Analysis courses achievement test with reliability index of 0.8119, and an attitude test concerning the students’ attitude toward the Mathematical Analysis courses learning activity for constructivism. The result of the research show that the efficiency of the Mathematical Analysis courses learning activity for constructivism is 73.05/72.16, which is more than expected criteria of 70/70. The research additionally find that the average score of learning achievement of students who engaged in the learning activities for constructivism are equal to 70% and the students’ attitude toward the learning activity for constructivism are at the medium level.

144
9998851
Optimal Design of Reference Node Placement for Wireless Indoor Positioning Systems in Multi-Floor Building
Abstract:

In this paper, we propose an optimization technique that can be used to optimize the placements of reference nodes and improve the location determination performance for the multi-floor building. The proposed technique is based on Simulated Annealing algorithm (SA) and is called MSMR-M. The performance study in this work is based on simulation. We compare other node-placement techniques found in the literature with the optimal node-placement solutions obtained from our optimization. The results show that using the optimal node-placement obtained by our proposed technique can improve the positioning error distances up to 20% better than those of the other techniques. The proposed technique can provide an average error distance within 1.42 meters.

143
9998845
On the Performance Analysis of Coexistence between IEEE 802.11g and IEEE 802.15.4 Networks
Abstract:

This paper presents an intensive measurement studying of the network performance analysis when IEEE 802.11g Wireless Local Area Networks (WLAN) coexisting with IEEE 802.15.4 Wireless Personal Area Network (WPAN). The measurement results show that the coexistence between both networks could increase the Frame Error Rate (FER) of the IEEE 802.15.4 networks up to 60% and it could decrease the throughputs of the IEEE 802.11g networks up to 55%.

142
9998844
An Enhanced Floor Estimation Algorithm for Indoor Wireless Localization Systems Using Confidence Interval Approach
Abstract:

Indoor wireless localization systems have played an important role to enhance context-aware services. Determining the position of mobile objects in complex indoor environments, such as those in multi-floor buildings, is very challenging problems. This paper presents an effective floor estimation algorithm, which can accurately determine the floor where mobile objects located. The proposed algorithm is based on the confidence interval of the summation of online Received Signal Strength (RSS) obtained from the IEEE 802.15.4 Wireless Sensor Networks (WSN).We compare the performance of the proposed algorithm with those of other floor estimation algorithms in literature by conducting a real implementation of WSN in our facility. The experimental results and analysis showed that the proposed floor estimation algorithm outperformed the other algorithms and provided highest percentage of floor accuracy up to 100% with 95-percent confidence interval.

141
9998843
Phytopathology Prediction in Dry Soil Using Artificial Neural Networks Modeling
Abstract:

The rapid expansion of deserts in recent decades as a result of human actions combined with climatic changes has highlighted the necessity to understand biological processes in arid environments. Whereas physical processes and the biology of flora and fauna have been relatively well studied in marginally used arid areas, knowledge of desert soil micro-organisms remains fragmentary. The objective of this study is to conduct a diversity analysis of bacterial communities in unvegetated arid soils. Several biological phenomena in hot deserts related to microbial populations and the potential use of micro-organisms for restoring hot desert environments. Dry land ecosystems have a highly heterogeneous distribution of resources, with greater nutrient concentrations and microbial densities occurring in vegetated than in bare soils. In this work, we found it useful to use techniques of artificial intelligence in their treatment especially artificial neural networks (ANN). The use of the ANN model, demonstrate his capability for addressing the complex problems of uncertainty data.

140
9998842
Phytoadaptation in Desert Soil Prediction Using Fuzzy Logic Modeling
Abstract:

In terms of ecology forecast effects of desertification, the purpose of this study is to develop a predictive model of growth and adaptation of species in arid environment and bioclimatic conditions. The impact of climate change and the desertification phenomena is the result of combined effects in magnitude and frequency of these phenomena. Like the data involved in the phytopathogenic process and bacteria growth in arid soil occur in an uncertain environment because of their complexity, it becomes necessary to have a suitable methodology for the analysis of these variables. The basic principles of fuzzy logic those are perfectly suited to this process. As input variables, we consider the physical parameters, soil type, bacteria nature, and plant species concerned. The result output variable is the adaptability of the species expressed by the growth rate or extinction. As a conclusion, we prevent the possible strategies for adaptation, with or without shifting areas of plantation and nature adequate vegetation.

139
9998841
Optical Heterodyning of Injection-Locked Laser Sources — A Novel Technique for Millimeter-Wave Signal Generation
Abstract:

A novel technique has been developed to generate ultra-stable millimeter-wave signal by optical heterodyning of the output from two slave laser (SL) sources injection-locked to the sidebands of a frequency modulated (FM) master laser (ML). Precise thermal tuning of the SL sources is required to lock the particular slave laser frequency to the desired FM sidebands of the ML. The output signals from the injection-locked SL when coherently heterodyned in a fast response photo detector like high electron mobility transistor (HEMT), extremely stable millimeter-wave signal having very narrow line width can be generated. The scheme may also be used to generate ultra-stable sub-millimeter-wave/terahertz signal.

138
9998840
A Case Study of Bee Algorithm for Ready Mixed Concrete Problem
Abstract:

This research proposes Bee Algorithm (BA) to optimize Ready Mixed Concrete (RMC) truck scheduling problem from single batch plant to multiple construction sites. This problem is considered as an NP-hard constrained combinatorial optimization problem. This paper provides the details of the RMC dispatching process and its related constraints. BA was then developed to minimize total waiting time of RMC trucks while satisfying all constraints. The performance of BA is then evaluated on two benchmark problems (3 and 5construction sites) according to previous researchers. The simulation results of BA are compared in term of efficiency and accuracy with Genetic Algorithm (GA) and all problems show that BA approach outperforms GA in term of efficiency and accuracy to obtain optimal solution. Hence, BA approach could be practically implemented to obtain the best schedule.

137
9998839
Neo Realism in Thai’s Film after Political Crisis in October 14, 1973 and Political Crisis between 2005-2014
Authors:
Abstract:

The objective of presenting this article is to analyze between Thai’s film and Thai society in political crisis, to study the development and trend of the film which reflects society in Thailand from political crisis of 14 October 1973 and the present day political crisis using a comparative study of the two era, both the similarities and differences in the film reflects the society in an era of change.

136
9998838
Effects of Maternal Nutrition at Different Stages of Pregnancy in Bali Cows on Growth Performance of the Offspring to Weaning
Abstract:

The objective of this study was to investigate the lifelong effect of in utero nutrition fed at different stages of pregnancy in Bali cows (n = 40): (U1) without in utero nutrition (0 – parturition, negative control); (U2) 0 – 90 d of gestation; (U3) 90 - 180 d of gestation; (U4) 180 d – parturition; and (U5) in utero nutrition along gestation period (0 d to parturition – positive control) on the growth performance of the offspring to weaning age. The results indicated that effect of maternal nutrition on male and female offspring were particularly indicated by the growth performance of both the male and female offspring from birth to weaning.

135
9998833
Gender Differences in Negotiation: Considering the Usual Driving Forces?
Abstract:

Negotiation is a specific form of interaction based on communication in which the parties enter into deliberately, each with clear but different interests or goals and a mutual dependency towards a decision due to be taken at the end of the confrontation. Consequently, negotiation is a complex activity involving many different disciplines from the strategic aspects and the decision making process to the evaluation of alternatives or outcomes and the exchange of information. While gender differences can be considered as one of the most researched topic within negotiation studies, empirical works and theory present many conflicting evidences and results about the role of gender in the process or the outcome. Furthermore, little interest has been shown over gender differences in the definition of what is negotiation, its essence or fundamental elements. Or, as differences exist in practices, it might be essential to study if the starting point of these discrepancies does not come from different considerations about what is negotiation and what will encourage the participants in their strategic decisions. Some recent and promising experiments made with diverse groups show that male and female participants in a common and shared situation barely consider the same way the concepts of power, trust or stakes which are largely considered as the usual driving forces of any negotiation. Furthermore, results from Human Resource self-assessment tests display and confirm considerable differences between individuals regarding essential behavioral dimensions like capacity to improvise and to achieve, aptitude to conciliate or to compete and orientation towards power and group domination which are also part of negotiation skills. Our intention in this paper is to confront these dimensions with negotiation’s usual driving forces in order to build up new paths for further research.

134
9998832
Modeling and Control Design of a Centralized Adaptive Cruise Control System
Abstract:

A vehicle driving with an Adaptive Cruise Control System (ACC) is usually controlled decentrally, based on the information of radar systems and in some publications based on C2X-Communication (CACC) to guarantee stable platoons. In this paper we present a Model Predictive Control (MPC) design of a centralized, server-based ACC-System, whereby the vehicular platoon is modeled and controlled as a whole. It is then proven that the proposed MPC design guarantees asymptotic stability and hence string stability of the platoon. The Networked MPC design is chosen to be able to integrate system constraints optimally as well as to reduce the effects of communication delay and packet loss. The performance of the proposed controller is then simulated and analyzed in an LTE communication scenario using the LTE/EPC Network Simulator LENA, which is based on the ns-3 network simulator.

133
9998831
Application of a New Efficient Normal Parameter Reduction Algorithm of Soft Sets in Online Shopping
Abstract:

A new efficient normal parameter reduction algorithm of soft set in decision making was proposed. However, up to the present, few documents have focused on real-life applications of this algorithm. Accordingly, we apply a New Efficient Normal Parameter Reduction algorithm into real-life datasets of online shopping, such as Blackberry Mobile Phone Dataset. Experimental results show that this algorithm is not only suitable but feasible for dealing with the online shopping.

132
9998830
A Study of the Growth of Single-Phase Mg0.5Zn0.5O Films for UV LED
Abstract:

Single-phase, high band gap energy Zn0.5Mg0.5O films were grown under oxygen pressure, using pulse laser deposition with a Zn0.5Mg0.5O target. Structural characterization studies revealed that the crystal structures of the ZnX-1MgXO films could be controlled via changes in the oxygen pressure. TEM analysis showed that the thickness of the deposited Zn1-xMgxO thin films was 50–75 nm. As the oxygen pressure increased, we found that one axis of the crystals did not show a very significant increase in the crystallization compared with that observed at low oxygen pressure. The X-ray diffraction peak intensity for the hexagonal-ZnMgO (002) plane increased relative to that for the cubic-ZnMgO (111) plane. The corresponding c-axis of the h-ZnMgO lattice constant increased from 5.141 to 5.148 Å, and the a-axis of the c-ZnMgO lattice constant decreased from 4.255 to 4.250 Å. EDX analysis showed that the Mg content in the mixed-phase ZnMgO films decreased significantly, from 54.25 to 46.96 at.%. As the oxygen pressure was increased from 100 to 150 mTorr, the absorption edge red-shifted from 3.96 to 3.81 eV; however, a film grown at the highest oxygen pressure tested here (200 mTorr).

Keywords:
131
9998829
Morphological Study of Trichomes in Indigofera wightii Grah. ex Wigh & Arn., Indigo Dye Species, Traditionally Used by “Thaisongdam” Thailand
Abstract:

The study aimed to collect morphological data of secretory structures that contribute to taxonomy of Indigofera. Detail features of trichomes occurrence in vegetative and reproductive organs of Indigofera wightii Grah. ex Wigh & Arn., a species traditionally used as source of indigo to dye “Thaisongdam” clothing were investigated. Examination through light microscopy and scanning electrom microscopy were done. Non secretory, T-shaped trichomes appeared throughout surfaces of stems, leaves, flowers and fruits. Secretory or glandular trichomes occurred in two types; one has big cylindrical head and short peduncle, distributed on adaxial surface of sepals and around the pedicel, whereas another possesses smaller cylindrical head but long peduncle. The latter was found on apical surface of immature pods. No phenolic and lipophilic compounds were detected from these glands.

130
9998828
An Effect of Organic Supplements on Stimulating Growth of Dendrobium Protocorms and Seedlings
Abstract:

This study was aimed to investigate the effect of various organic supplements on growth and development of Dendrobium discolor’s protocorms and seedlings growth of Dendrobium Judy Rutz. Protocorms of Dendrobium discolor with 2.0 cm. in diameter and seedlings of Dendrobium Judy Rutz at the same size (0.5 cm. height) were sub-cultured on Hyponex medium supplemented with cow milk (CM), soy milk (SM), potato extract (PE) and peptone (P) for 2 months. The protocorms were developed to seedlings in all treatments after cultured for 2 months. However, the best results were found on Hyponex medium supplemented with P was the best in which the maximum fresh and dry weight and maximum shoot height were obtained in this treatment statistically different (p ≤ 0.05) to other treatments. Moreover, Hyponex medium supplemented with P also stimulated the maximum mean number of 5.7 shoots per explant which also showed statistically different (p ≤ 0.05) when compared to other treatments. The results of growth of Dendrobium Judy Rutz seedlings indicated the medium supplemented with 100 mL/L PE enhanced the maximum fresh and dry weigh per explants with significantly different (p ≤ 0.05) in fresh weight from other treatments including the control medium without any organic supplementation. However, the dry weight was not significantly different (p ≤ 0.05) from medium supplemented with SM and P. There was multiple shoots induction in all media with or without organic supplementation ranging from 2.6 to 3 shoots per explants. The maximum shoot height was also obtained in the seedlings cultured on medium supplemented with PE while the longest root length was found in medium supplemented with SM.

129
9998827
An Effect of Organic Supplements on Stimulating Growth of Vanda and Mokara Seedlings in Tissue Culture
Abstract:

This study aimed to investigate effect of different organic supplements on growth of Vanda and Mokara seedlings. Vanda and Mokara seedlings approximately 0.2 and 0.3 cm. in height were sub-cultured onto VW supplemented with 150 ml/L coconut water, 100 g/L potato extract, 100 g/L ‘Gros Michel’ banana (AAA group) and 100 g/L ‘Namwa’ banana (ABB group). The explants were sub-cultured onto the same medium every month for 3 months. The best medium increased stem height to 0.52 and 0.44 Cm. in Vanda and Mokara respectively was supplemented with coconut water. The maximum fresh weight of Vanda (0.59 g) was found on medium supplemented with ‘Gros Michel’ banana while Mokara cultured on medium supplemented with Potato extract had the maximum fresh weight (0.27 g) and number of roots (5.20 roots/shoot) statistically different (p≤ 0.05) to other treatments. However, Vanda cultured on medium supplemented with ‘Namwa’ banana had the maximum number of roots (3.80 roots/shoot). Our results suggested that growth of different orchid genera was responded diversely to different organic supplements. 

 

128
9998826
Ethnobotanical Survey of Vegetable Plants Traditionally Used in Kalasin Thailand
Abstract:

Use of plants grown in local area for edible has a long tradition in different culture. The indigenous knowledge such as usage of plants as vegetables by local people is risk to disappear when no records are done. In order to conserve and transfer this valuable heritage to the new generation, ethnobotanical study should be investigated and documented. The survey of vegetable plants traditionally used was carried out in the year 2012. Information was accumulated via questionnaires and oral interviewing from 100 people living in 36 villages of 9 districts in Amphoe Huai Mek, Kalasin, Thailand. Local plant names, utilized parts and preparation methods of the plants were recorded. Each mentioned plant species were collected and voucher specimens were prepared. A total of 55 vegetable plant species belonging to 34 families and 54 genera were identified. The plant habits were tree, shrub, herb, climber, and shrubby fern at 21.82%, 18.18%, 38.18%, 20.00% and 1.82% respectively. The most encountered vegetable plant families were Leguminosae (20%), Cucurbitaceae (7.27%), Apiaceae (5.45%), whereas families with 3.64% uses were Araceae, Bignoniaceae, Lamiaceae, Passifloraceae, Piperaceae and Solanaceae. The most common consumptions were fresh or brief boiled young shoot or young leaf as side dishes of ‘jaeo, laab, namprik, pon’ or curries. Most locally known vegetables included 45% of the studied plants which grow along road side, backyard garden, hedgerow, open forest and rice field.

127
9998825
Active Learning in Computer Exercises on Electronics
Abstract:

Modelling and simulation provide effective way to acquire engineering experience. An active approach to modelling and simulation proposed in the paper involves, beside the compulsory part directed by the traditional step-by-step instructions, the new optional part basing on the human’s habits to design thus stimulating the efforts towards success in active learning. Computer exercises as a part of engineering curriculum incorporate a set of effective activities. In addition to the knowledge acquired in theoretical training, the described educational arrangement helps to develop problem solutions, computation skills, and experimentation performance along with enhancement of practical experience and qualification.

126
9998824
Effects of Molybdenum on Phosphorus Concentration in Rice (Oryza sativa L.)
Abstract:

A hydroponic trial was carried out to investigate the effect of molybdenum (Mo) on uptake of phosphorus (P) in different rice cultivars. The experiment was conducted using a randomized complete-block design, with a split-plot arrangement of treatments and three replications. Four rates of Mo (0, 0.01, 0.1 and 1 mg L−1) and five cultivars (MR219, HASHEMI, MR232, FAJRE and MR253) provided the main and sub-plots, respectively. Interaction of molybdenum×variety was significant on shoot phosphorus uptake (p≤0.01). Highest and lowest shoot phosphorus uptake were seen in Mo3V3 (0.6% plant-1) and Mo0V3 (0.14% plant-1) treatments, respectively. Molybdenum did not have a significant effect on root phosphorus content. According to results, application of molybdenum has a synergistic effect on uptake of phosphorus by rice plants.

125
9998823
Field Application of Reduced Crude Conversion Spent Lime
Abstract:

Gypsum is being applied to ameliorate subsoil acidity and to overcome the problem of very slow lime movement from surface lime applications. Reduced Crude Conversion Spent Lime (RCCSL) containing anhydrite was evaluated for use as a liming material with specific consideration given to the movement of sulfate into the acid subsoil. Agricultural lime and RCCSL were applied at 0, 0.5, 1.0, and 1.5 times the lime requirement of 6.72 Mg ha-1 to an acid Trappist silt loam (TypicHapuldult). Corn [Zea mays (L.)]was grown following lime material application and soybean [Glycine max (L.) Merr.]was grown in the second year.Soil pH increased rapidly with the addition of the RCCSL material. Over time there was no difference in soil pH between the materials but there was with increasing rate. None of the observed changes in plant nutrient concentration had an impact on yield. Grain yield was higher for the RCCSL amended treatments in the first year but not in the second. There was a significant increase in soybean grain yield from the full lime requirement treatments over no lime.

124
9998822
Monitoring the Fiscal Health of Taiwan’s Local Government: Application of the 10-Point Scale of Fiscal Distress
Abstract:

This article presents a monitoring indicators system that predicts whether a local government in Taiwan is heading for fiscal distress and identifies a suitable fiscal policy that would allow the local government to achieve fiscal balance in the long run. This system is relevant to stockholders’ interest, simple for national audit bodies to use, and provides an early warning of fiscal distress that allows preventative action to be taken.

123
9998821
Heavy Metal Concentration in Orchard Area, Amphawa District, Samut Songkram Province, Thailand
Abstract:

A study was conducted in May to July 2013 with the aim of determination of heavy metal concentration in orchard area. 60 samples were collected and analyzed for Cadmium (Cd), Copper (Cu), Lead (Pb), and Zinc (Zn) by Atomic Absorption Spectrophotometer (AAS).

The heavy metal concentrations in sediment of orchards, that use chemical for Cd (1.13 ± 0.26 mg/l), Cu (8.00 ± 1.05 mg/l), Pb (13.16 ± 2.01) and Zn (37.41 ± 3.20 mg/l). The heavy metal concentrations in sediment of the orchards, that do not use chemical for Cd (1.28 ± 0.50 mg/l), Cu (7.60 ± 1.20 mg/l), Pb (29.87 ± 4.88) and Zn (21.79 ± 2.98 mg/l). Statistical analysis between heavy metal in sediment from the orchard, that use chemical and the orchard, that not use chemical were difference statistic significant of 0.5 level of significant for Cd and Pb while no statistically difference for Cu and Zn.

122
9998820
Leadership´s Controlling via Complexity Investigation in Crisis Scenarios
Abstract:

In this paper will be discussed two coin´s sides of crisis scenarios dynamics. On the one's side is negative role of subsidiary scenario branches in its compactness weakening by means unduly chaotic atomizing, having many interactive feedbacks cases, increasing a value of a complexity here. This negative role reflects the complexity of use cases, weakening leader compliancy, which brings something as a ´readiness for controlling capabilities provision´. Leader´s dissatisfaction has zero compliancy, but factual it is a ´crossbar´ (interface in fact) between planning and executing use cases. On the other side of this coin, an advantage of rich scenarios embranchment is possible to see in a support of response awareness, readiness, preparedness, adaptability, creativity and flexibility. Here rich scenarios embranchment contributes to the steadiness and resistance of scenario mission actors. These all will be presented in live power-points ´Blazons´, modelled via DYVELOP (Dynamic Vector Logistics of Processes) on the Conference.

121
9998818
Visual Identity Components of Tourist Destination
Abstract:

In the world of modern communications, visual identity has predominant influence on the overall success of tourist destinations, but despite of these, the problem of designing thriving tourist destination visual identity and their components are hardly addressed. This study highlights the importance of building and managing the visual identity of tourist destination, and based on the empirical study of well-known Mediterranean destination of Croatia analyses three main components of tourist destination visual identity; name, slogan, and logo. Moreover, the paper shows how respondents perceive each component of Croatia’s visual identity. According to study, logo is the most important, followed by the name and slogan. Research also reveals that Croatian economy lags behind developed countries in understanding the importance of visual identity, and its influence on marketing goal achievements.

120
9998816
The Size Effects of Keyboards (Keycaps) on Computer Typing Tasks
Abstract:

Keyboard is the most important equipment for computer tasks. However, improper design of keyboard would cause some symptoms like ulnar and/or radial deviations. The research goal of this study was to investigate the optimal size(s) of keycaps to increase efficiency. As shown in the questionnaire pre-study with 49 participants aged from 20 to 44, the most commonly used keyboards were 101-key standard keyboards. Most of the keycap sizes (W×L) were 1.3×1.5 cm and 1.5×1.5 cm. The fingertip breadths of most participants were 1.2 cm. Therefore, in the main study with 18 participants, a standard keyboard with each set of the 3-sized (1.2×1.4 cm, 1.3×1.5 cm, and 1.5×1.5 cm) keycaps were used to investigate their typing efficiency, respectively. The results revealed that the differences between the operating times for using 1.3×1.5 cm and 1.2×1.4 cm keycaps was insignificant while operating times for using 1.5×1.5cm keycaps were significantly longer than for using 1.2×1.4 cm or 1.3×1.5 cm, respectively. As for typing error rate, there was no significant difference.

119
9998817
Experimental Study on Ultrasonic Shot Peening Forming and Surface Properties of AALY12
Abstract:

Ultrasonic shot peening (USP) on AALY12 sheet was studied. Several parameters (arc heights, surface roughness, surface topography and micro hardness) with different USP process parameters were measured. The research proposes that radius of curvature of shot peened sheet increases with time and electric current decreasing, while increases with pin diameter increasing, and radius of curvature reaches a saturation level after a specific processing time and electric current. An empirical model of the relationship between radius of curvature and pin diameter, electric current, time was also obtained. The research shows that the increment of surface and vertical micro hardness of material is more obvious with longer time and higher value of electric current, which can be up to 20% and 28% respectively.

118
9998815
Qualitative Characteristics of Meat from Lambs Fed Hydrolyzed Sugarcane
Abstract:

We used 24 Ile de France lambs, weighing between 15 and 32 kg (BW). Treatments were supplemented with concentrate: “in nature” sugarcane (IN), sugarcane hydrolyzed using 0.6% calcium oxide (CaO) under aerobic condition (AER), and sugarcane hydrolyzed using 0.6% CaO under anaerobic condition (ANA), constituting a completely randomized design with eight repetitions per treatment. Lambs were housed in individual stalls and fed into the through, allowing 10% of leftovers. Lambs were slaughtered when body weight reached 32 kg. The following parameters were determined on Longissimu lumborum muscle of hot and cold carcasses: pH and color, 45 minutes and 24 hours after slaughtering. Qualitative analysis of the meat were performed in the loins, water-holding capacity (WHC), cooking loss (CL), and shear force (SF). We used a completely randomized design with three treatments and eight repetitions. Means were compared by Tukey test at 5% significance. A higher value for redness (a*) 45 minutes after slaughter (10.48) were found for lambs fed hydrolyzed under anaerobic conditions sugarcane. The other qualitative characteristics of meat were not affected by treatments (P >0.05). The comparison of meat quality resulting from the treatments shows that it is possible to feed in nature sugarcane to lambs, thus waiving hydrolyses process and the spending with alkalizing agent.

117
9998814
Diversity and Distribution of Benthic Invertebrates in the West Port, Malaysia
Abstract:

The purpose of this paper is to describe the main characteristics of macroinvertebrate species in response to environmental forcing factors. Overall, 23 species of Mollusca, 4 species of Arthropods, 3 species of Echinodermata and 3 species of Annelida were identified at the 9 sampling stations during four sampling periods. Individual species of Mollusca constituted 36.4% of the total abundance, followed by Arthropods (27.01%), Annelida (34.3%) and Echinodermata (2.4%). The results of Kruskal-Wallis test indicated that a significant difference (p <0.05) in the abundance, richness and diversity of the macro-benthic community in different stations. The correlation analysis revealed that anthropogenic pollution and natural variability caused by these variations in spatial scales.

116
9998813
Exploring the Factors of Inter-Organizational Knowledge Sharing
Abstract:

Interorganizational knowledge sharing is the major driving force to maximize the operational benefits across supply chain. Trust is considered as the key to facilitate knowledge sharing. This research proposes shared values and relational embeddedness as antecedents of interorganizational trust. Survey based on managers in major industrial parks in Taiwan confirm that trust is enforced when organizations develop shared values and formed social relational embeddedness. Trust leads to interorganizational knowledge sharing. This research has theoretical and practical implications.

115
9998811
Dried Venison Quality Parameters Changes during Storage
Abstract:

The aim of the current research was to determine quality parameters changes of dried venison during storage. Protein, fat and moisture content dynamics as well microbiological quality was analyzed. For the experiments the meat (0.02×4.00×7.00 cm) pieces were marinated in “teriyaki sauce” marinade (composition: teriyaki sauce, sweet and sour sauce, taco sauce, soy sauce, American BBQ sauce hickory, sesame oil, garlic, garlic salt, tabasco red pepper sauce) at 4±2°C temperature for 48±1h. Sodium monophosphate (E339) was also added in part of marinade to improve the meat textural properties. After marinating, meat samples were dried in microwave-vacuum drier MUSSON–1, packaged in vacuum pouches made from polymer film (PA/PE) with barrier properties and storage for 4 months at 18±1°C temperature in dark place. Dried venison samples were analyzed after 0, 35, 91 and 112 days of storage. During the storage total plate counts of dried venison samples significantly (p<0.05) increased. No significant differences in the content of protein, fat and moisture were detected when analyzing dried meat samples during storage and comparing them with the chemical parameters of just dried meat.

114
9998810
Air Cargo Overbooking Model under Stochastic Weight and Volume Cancellation
Abstract:

Overbooking is an approach of selling more goods or services than available capacities because sellers anticipate that some buyers will not show-up or may cancel their bookings. At present, many airlines deploy overbooking strategy in order to deal with the uncertainty of their customers. Particularly, some airlines sell more cargo capacity than what they have available to freight forwarders with beliefs that some of them will cancel later. In this paper, we propose methods to find the optimal overbooking level of volume and weight for air cargo in order to minimize the total cost, containing cost of spoilage and cost of offloaded. Cancellations of volume and weight are jointly random variables with a known joint distribution. Heuristic approaches applying the idea of weight and volume independency is considered to find an appropriate answer to the full problem. Computational experiments are used to explore the performance of approaches presented in this paper, as compared to a naïve method under different scenarios.

113
9998809
Developing of Knowledge-Based System for the Medical Treatment with Herbs
Abstract:

This research aims to create a knowledge-based system as a database for self-healthcare analysis, diagnosis of simple illnesses, and the use of Thai herbs instead of modern medicine by using principles of Thai traditional medication theory. These were disseminated by website network programs within Suan Sunandha Rajabhat University. The population used in this study was divided into two groups: the first group consisted of four experts of Thai traditional medication and the second group was 300 website users. The methods used for collecting data were paper questionnaires and poll questionnaires on the website. The statistics used for analyzing data was at an average level. The results were divided into three parts: the first part was the development of a knowledge-based system and the second part was applied programs on website. Both parts could be fulfilled and achieved according to the set goal. The third part was the evaluation of the study: The evaluation of the viewpoints of the experts towards website designs were evaluated at a good level of 4.20. The satisfaction evaluation of the users was found at a good level of average satisfactory level at 4.24. It was found that the young population of those under the age of 16 had less cares about their health than the population of other teenagers, working age adults and those of older age. The research findings should be extended in order to encourage the lifestyle modifications to people of all ages by using the self-healthcare principles.

112
9998806
The Effects of NaF Concentration on the Zinc Coating Electroplated in Supercritical CO2 Mixed Zinc Chloride Bath
Abstract:

This research studies the electroplating of zinc coating in the zinc chloride bath mixed with supercritical CO2. The sodium fluoride (NaF) was used as the bath additive to change the structure and property of the coating, and therefore the roughness and corrosion resistance of the zinc coating was investigated. The surface characterization was performed using optical microscope (OM), X-ray diffractometer (XRD), and α-step profilometer. Moreover, the potentiodynamic polarization measurement in 3% NaCl solution was employed in the corrosion resistance evaluation. Because of the emulsification of the electrolyte mixed in Sc-CO2, the electroplated zinc produced the coating with smoother surface, smaller grain, better throwing power and higher corrosion resistance. The main role played by the NaF was to reduce the coating’s roughness and grain size. In other words, the CO2 mixed with the electrolyte under the supercritical condition performed the similar function as brighter and leveler in zinc electroplating to enhance the throwing power and corrosion resistance of the coating.

111
9998805
Performance Evaluation of Content Based Image Retrieval Using Indexed Views
Abstract:

Digital information is expanding in exponential order in our life. Information that is residing online and offline are stored in huge repositories relating to every aspect of our lives. Getting the required information is a task of retrieval systems. Content based image retrieval (CBIR) is a retrieval system that retrieves the required information from repositories on the basis of the contents of the image. Time is a critical factor in retrieval system and using indexed views with CBIR system improves the time efficiency of retrieved results.

110
9998796
TRACE/FRAPTRAN Analysis of Kuosheng Nuclear Power Plant Dry-Storage System
Abstract:

The dry-storage systems of nuclear power plants (NPPs) in Taiwan have become one of the major safety concerns. There are two steps considered in this study. The first step is the verification of the TRACE by using VSC-17 experimental data. The results of TRACE were similar to the VSC-17 data. It indicates that TRACE has the respectable accuracy in the simulation and analysis of the dry-storage systems. The next step is the application of TRACE in the dry-storage system of Kuosheng NPP (BWR/6). Kuosheng NPP is the second BWR NPP of Taiwan Power Company. In order to solve the storage of the spent fuels, Taiwan Power Company developed the new dry-storage system for Kuosheng NPP. In this step, the dry-storage system model of Kuosheng NPP was established by TRACE. Then, the steady state simulation of this model was performed and the results of TRACE were compared with the Kuosheng NPP data. Finally, this model was used to perform the safety analysis of Kuosheng NPP dry-storage system. Besides, FRAPTRAN was used tocalculate the transient performance of fuel rods.

109
9998795
Error Analysis of English Inflection among Thai University Students
Abstract:

The linguistic competence of Thai university students majoring in Business English was examined in the context of knowledge of English language inflection, and also various linguistic elements. Errors analysis was applied to the results of the testing. Levels of errors in inflection, tense and linguistic elements were shown to be significantly high for all noun, verb and adjective inflections. Findings suggest that students do not gain linguistic competence in their use of English language inflection, because of interlanguage interference. Implications for curriculum reform and treatment of errors in the classroom are discussed.

108
9998793
Reliability-Based Life-Cycle Cost Model for Engineering Systems
Abstract:

The effect of reliability on life-cycle cost, including initial and maintenance cost of a system is studied. The failure probability of a component is used to calculate the average maintenance cost during the operation cycle of the component. The standard deviation of the life-cycle cost is also calculated as an error measure for the average life-cycle cost. As a numerical example, the model is used to study the average life-cycle cost of an electric motor.

107
9998792
Employee Aggression, Labeling and Emotional Intelligence
Abstract:

The aims of this research are to broaden the study on the relationship between emotional intelligence and counterproductive work behavior (CWB). The study sample consisted in 441 Romanian employees from companies all over the country. Data has been collected through web surveys and processed with SPSS. The results indicated an average correlation between the two constructs and their sub variables, employees with a high level of emotional intelligence tend to be less aggressive. In addition, labeling was considered an individual difference which has the power to influence the level of employee aggression. A regression model was used to underline the importance of emotional intelligence together with labeling as predictors of CWB. Results have shown that this regression model enforces the assumption that labeling and emotional intelligence, taken together, predict CWB. Employees, who label themselves as victims and have a low degree of emotional intelligence, have a higher level of CWB.

106
9998790
DNA Methylation Changes Caused by Lawsone
Abstract:

Lawsone is a pigment that occurs naturally in plants. It has been used as a skin and hair dye for a long time. Moreover, its different biological activities have been reported. The present study focused on the effect of lawsone on a plant cell model represented by tobacco BY-2 cell suspension culture, which is used as a model comparable with the HeLa cells. It has been shown that lawsone inhibits the cell growth in the concentration-dependent manner. In addition, changes in DNA methylation level have been determined. We observed decreasing level of DNA methylation in the presence of increasing concentrations of lawsone. These results were accompanied with overproduction of reactive oxygen species (ROS). Since epigenetic modifications can be caused by different stress factors, there could be a connection between the changes in the level of DNA methylation and ROS production caused by lawsone.

105
9998789
Resistance Training as a Powerful Tool in the Prevention and Treatment of Cardiovascular Diseases
Abstract:

Regular exercise promotes reduction in blood pressure, reduction in body weight and it also helps to increase in insulin sensitivity. Participation in physical activity should always be linked to medical screening which can reveal serious medical problems. One of them is high blood pressure. Hypertension is risk factor for one billion people worldwide and the highest prevalence is found in Africa. Another component of hypertension is that people who suffer from hypertension have no symptoms. It is estimated that reduction of 3mm Hg in Systolic Blood Pressure decreases cardiac morbidity at least 5%. The most of the guidelines suggest aerobic exercise in a prevention of cardiovascular diseases. On the other hand, it is important to emphasize the impact of resistance training. Even, it was found higher effect for reduction on the level of systolic blood pressure than aerobic exercise.

104
9998788
Students´ Knowledge, or Random Choice in ESP?
Abstract:

As widely accepted, didactic multiple-choice tests are referred as a tool providing feedback easily and quickly. Despite the final test scores are corrected by a special formula and number of high plausibility distractors is taken into consideration, the results may be influenced by the random choice. The survey was held in three academic years at the Faculty of Informatics and Management, University of Hradec Kralove, Czech Republic, where the multiple-choice test scores were compared to the open-answer ones. The research sample included 567 respondents. The collected data were processed by the NCSS2007 statistic software by the method of frequency and multiple regression analysis and presented in the form of figures and tables. The results proved statistically significant differences in test scores in academic years 2 and 3, and were discussed from the point of the credit system and conditions for teaching/learning English in the Czech education system.

103
9998787
Impact of Node Density and Transmission Range on the Performance of OLSR and DSDV Routing Protocols in VANET City Scenarios
Abstract:

Vehicular Ad hoc Network (VANET) is a special case of Mobile Ad hoc Network (MANET) used to establish communications and exchange information among nearby vehicles and between vehicles and nearby fixed infrastructure. VANET is seen as a promising technology used to provide safety, efficiency, assistance and comfort to the road users. Routing is an important issue in Vehicular Ad Hoc Network to find and maintain communication between vehicles due to the highly dynamic topology, frequently disconnected network and mobility constraints.

This paper evaluates the performance of two most popular proactive routing protocols OLSR and DSDV in real city traffic scenario on the basis of three metrics namely Packet delivery ratio, throughput and average end to end delay by varying vehicles density and transmission range.

102
9998785
Secondary Science Teachers’ Views about Purposes of Practical Works in School Science
Abstract:

The purpose of this paper was to examine views of secondary school science teachers about purposes to use practical works in school science. The instrument to survey consisted eighteen items, which were categorized into four components as follows: ‘Scientific inquiry’, ‘Scientific knowledge’, ‘Science-related attitude’, and ‘STS (science-technology-society)’. Subjects were 152 secondary school science teachers (male 70 and female 82; middle school 50 and high school 102), who are teaching in 42 schools of 8 provinces. On the survey, science teachers were asked to answer on 5-point Lickert scale (from 1 to 5) how they thought of using practical works on purposes with domains of science objectives in school. They had positive views about using practical works for improving scientific inquiry process skills, science-related attitudes, and perceptions about STS literacy, and acquiring scientific knowledge. They would have the most willingness of using practical works for ‘Scientific Inquiry’ among domains of science objectives in school.

101
9998784
Undergraduate Students’ Attitude towards the Statistics Course
Abstract:

The purpose of this study was to address and comparison of the attitudes towards the statistics course for undergraduate students. Data were collected from 120 students in Faculty of Sciences and Technology, Suan Sunandha Rajabhat University who enrolled in the statistics course. The quantitative approach was used to investigate the assessment and comparison of attitudes towards statistics course. It was revealed that the overall attitudes somewhat agree both in pre-test and post-test. In addition, the comparison of students’ attitudes towards the statistic course (Form A) has no difference in the overall attitudes. However, there is statistical significance in all dimensions and overall attitudes towards the statistics course (Form B).

100
9998783
Model Predictive 2DOF PID Slip Suppression Control of Electric Vehicle under Braking
Authors:
Abstract:

In this paper, a 2DOF (two degrees of freedom) PID (Proportional-Integral-Derivative) controller based on MPC (Model predictive control) algorithm fo slip suppression of EV (Electric Vehicle) under braking is proposed. The proposed method aims to improve the safety and the stability of EVs under braking by controlling the wheel slip ration. There also include numerical simulation results to demonstrate the effectiveness of the method.

99
9998781
An EWMA p Chart Based On Improved Square Root Transformation
Abstract:

Generally, the traditional Shewhart p chart has been developed by for charting the binomial data. This chart has been developed using the normal approximation with condition as low defect level and the small to moderate sample size. In real applications, however, are away from these assumptions due to skewness in the exact distribution. In this paper, a modified Exponentially Weighted Moving Average (EWMA) control chat for detecting a change in binomial data by improving square root transformations, namely ISRT p EWMA control chart. The numerical results show that ISRT p EWMA chart is superior to ISRT p chart for small to moderate shifts, otherwise, the latter is better for large shifts.

98
9998779
A Development of a Weight-Balancing Control System Based On Android Operating System
Abstract:

This paper describes the development of a Weight- Balancing Control System based on the Android Operating System and it provides recommendations on ways of balancing of user’s weight based on daily metabolism process and need so that user can make informed decisions on his or her weight controls. The system also depicts more information on nutrition details. Furthermore, it was designed to suggest to users what kinds of foods they should eat and how to exercise in the right ways. We describe the design methods and functional components of this prototype. To evaluate the system performance, questionnaires for system usability and Black Box Testing were used to measure expert and user satisfaction. The results were satisfactory as followed: Means for experts and users were 3.94 and 4.07 respectively.

97
9998777
Catalytic Cracking of Butene to Propylene over Modified HZSM-5 Zeolites
Abstract:

Catalytic cracking of butene to propylene was carried out in a continuous-flow fixed-bed reactor over HZSM-5 catalysts modified by nickel and phosphorus. The structure and acidity of catalysts were measured by N2 adsorption, NH3-TPD and XPS. The results revealed that surface area and strong acid sites both decreased with increasing phosphorus loadings. The increment of phosphorus loadings reduced the butene conversion but enhanced the propylene selectivity and catalyst stability.

96
9998776
Na Promoted Ni/γ-Al2O3 Catalysts Prepared by Solution Combustion Method for Syngas Methanation
Abstract:

Ni-based catalysts with different amounts of Na as promoter from 2 to 6 wt % were prepared by solution combustion method. The catalytic activity was investigated in syngas methanation reaction. Carbon oxides conversion and methane selectivity are greatly influenced by sodium loading. Adding 2 wt% Na remarkably improves catalytic activity and long-term stability, attributed to its smaller mean NiO particle size, better distribution, and milder metal-support interaction. However, excess addition of Na results in deactivation distinctly due to the blockage of active sites.

95
9998773
Computational Study and Wear Prediction of Steam Turbine Blade with Titanium-Nitride Coating Deposited by Physical Vapor Deposition Method
Abstract:

This work investigates the wear of a steam turbine blade coated with titanium nitride (TiN), and compares to the wear of uncoated blades. The coating is deposited on by physical vapor deposition (PVD) method. The working conditions of the blade were simulated and surface temperature and pressure values as well as flow velocity and flow direction were obtained. This data was used in the finite element wear model developed here in order to predict the wear of the blade. The wear mechanisms considered are erosive wear due to particle impingement and fluid jet, and fatigue wear due to repeated impingement of particles and fluid jet. Results show that the life of the TiN-coated blade is approximately 1.76 times longer than the life of the uncoated one.

94
9998771
Zinc Contaminate on Urban Roadside in Rush Hour, Bangkok, Thailand
Abstract:

This research aims to study the Zinc (Zn) concentration in fine particulate matter on Rajchawithee roadside in rush hour. 30 Samples were collected in Jun to August 2013 by 8 stage non-avaible cascade impactor. Each samples (filter paper) were digest with nitric acid and analyed by atomic absorption spectrophotometer for Zinc determination. The highest value for the mean fraction (18.00 ± 9.28%) is the size 9.0 – 110.0 micron follow by the range 3.3 – 4.7 micron (14.77 ± 14.66 %) and 1.1 – 2.1 micron (14.01 ± 11.77 %). The concentration of Zn in the particulate matter of range 0.43 – 0.7mm, 0.7 – 1.1 mm, 1.1 – 2.1 mm, 2.1 – 3.3 mm, 3.3 – 4.7 mm, 4.7 – 5.8 mm, 5.8 – 9.0 mm, 9.0 – 10.0 mm, were 41.56 – 217.62 mg/m3 (175.86 ±32.25 mg/m3), 152.60 – 217.24 mg/m3 (187.71 ± 17.42 mg/m3), 142.90 – 214.67 mg/m3(180.95 ± 18.71 mg/m3), 155.48 – 218.19 mg/m3(183.22 ± 19.94 mg/m3), 151.72 – 217.39 mg/m3(181.85 ± 17.57 mg/m3), 133.86 – 220.17 mg/m3 (178.78 ± 23.45 mg/m3), 160.00 – 220.35 mg/m3 (182.58 ± 18.08 mg/m3), 153.30 – 226.70 mg/m3 (181.52 ± 20.05 mg/m3), respectively. The Zn concentration in each size of particulate matter was not statistically significant different (p > .005)

93
9998769
Synthesis of Magnesium Borates from the Slurries of Magnesium Wastes by Microwave Energy
Abstract:

In this research, it is aimed not only microwave synthesis of magnesium borates but also evaluation of magnesium wastes. Synthesis process can be described with the reaction of Mg wastes and boric acid using microwave energy. X-Ray Diffraction (XRD) and Fourier Transform Infrared Spectroscopy (FT-IR) were applied to synthesized minerals. According to XRD results, magnesium borate hydrate mixtures were obtained as mcallisterite (pdf# = 01-070-1902, Mg2(B6O7(OH)6)2.9(H2O)) at higher crystallinity properties was achieved at the mole ratio raw material 1:1. Also, other kinds of magnesium borate hydrates were obtained at lower crystallinity such as admontite (pdf # = 01-076-0540, MgO(B2O3)3.7(H2O)), inderite (pdf # = 01-072-2308, 2MgO.3B2O3.15(H2O)) and magnesium borate hydrates (pdf # = 01-076-0539, MgO(B2O3)3.6(H2O)). FT-IR spectrums indicated that minor changes were seen at the band values of characteristic stretching in each experiment. At the end of experiments it is seen that using microwave energy may contribute positive effects to design of synthesis process such as reducing reaction time and products at higher crystallinity.

92
9998768
The Determination of the Zinc Sulfate, Sodium Hydroxide and Boric Acid Molar Ratio on the Production of Zinc Borates
Abstract:

Zinc borate is an important boron compound that can be used as multi-functional flame retardant additive due to its high dehydration temperature property. In this study, theraw materials of ZnSO4.7H2O, NaOH and H3BO3werecharacterized by X-Ray Diffraction (XRD) and Fourier Transform Infrared Spectroscopy (FT-IR) and used in the synthesis of zinc borates.The synthesis parameters were set to 100°C reaction temperature and 120 minutes of reaction time, with different molar ratio of starting materials (ZnSO4.7H2O:NaOH:H3BO3). After the zinc borate synthesis, the identifications of the products were conducted by XRD and FT-IR. As a result,Zinc Oxide Borate Hydrate [Zn3B6O12.3.5H2O], were synthesized at the molar ratios of 1:1:3, 1:1:4, 1:2:5 and 1:2:6. Among these ratios 1:2:6 had the best results.

91
9998767
Methanation Catalyst for Low CO Concentration
Abstract:

A Ni-based catalyst supported by γ-Al2O3 was prepared by impregnation method, and the catalyst was used in a low CO and CO2 concentration methanation system. The effect of temperature, pressure and space velocity on the methanation reaction was investigated in an experimental fixed-bed reactor. The methanation reaction was operated at the conditions of 190-240°C, 3000-24000ml•g-1•h-1 and 1.5-3.5MPa. The results show that temperature and space velocity play important role on the reaction. With the increase of reaction temperature the CO and CO2 conversion increase and the selectivity of CH4 increase. And with the increase of the space velocity the conversion of CO and CO2 and the selectivity of CH4 decrease sharply.

90
9998766
A Cross-Disciplinary Educational Model in Biomanufacturing to Sustain a Competitive Workforce Ecosystem
Abstract:

Biopharmaceuticals manufacturing is one of the major economic activities worldwide. Ninety-three percent of the workforce in a biomanufacturing environment concentrates in production-related areas. As a result, strategic collaborations between industry and academia are crucial to ensure the availability of knowledgeable workforce needed in an economic region to become competitive in biomanufacturing. In the past decade, our institution has been a key strategic partner with multinational biotechnology companies in supplying science and engineering graduates in the field of industrial biotechnology. Initiatives addressing all levels of the educational pipeline, from K-12 to college to continued education for company employees have been established along a ten-year span. The Amgen BioTalents Program was designed to provide undergraduate science and engineering students with training in biomanufacturing. The areas targeted by this educational program enhance their academic development, since these topics are not part of their traditional science and engineering curricula. The educational curriculum involved the process of producing a biomolecule from the genetic engineering of cells to the production of an especially targeted polypeptide, protein expression and purification, to quality control, and validation. This paper will report and describe the implementation details and outcomes of the first sessions of the program.

89
9998765
Phase Diagram Including a Negative Pressure Region for a Thermotropic Liquid Crystal in a Metal Berthelot Tube
Authors:
Abstract:

Thermodynamic properties of liquids under negative pressures are interesting and important in fields of scienceand technology. Here, phase transitions of a thermotropic liquid crystal are investigatedin a range from positive to negative pressures with a metal Berthelot tube using a commercial pressure transducer.Two co-existinglines, namely crystal (Kr) –nematic (N), and isotropic liquid (I) - nematic (N) lines, weredrawn in a pressure - temperature plane. The I-N line was drawn to ca. -5 (MPa).

88
9998764
Women’s Rights in Conflict with People’s Cultural Autonomy: Problems of Cultural Accommodation
Authors:
Abstract:

The paper explores the cultural rights accommodation by the state which has left many unresolved problems. The cultural rights sometimes violate the basic individual rights of the members inside the community like women. The paper further explicates certain cultural norms and practices which violates the rights of women inside the community in the name of culture.

87
9998763
Optimal Control of Volterra Integro-Differential Systems Based On Legendre Wavelets and Collocation Method
Abstract:

In this paper, the numerical solution of optimal control problem (OCP) for systems governed by Volterra integro-differential (VID) equation is considered. The method is developed by means of the Legendre wavelet approximation and collocation method. The properties of Legendre wavelet together with Gaussian integration method are utilized to reduce the problem to the solution of nonlinear programming one. Some numerical examples are given to confirm the accuracy and ease of implementation of the method.

86
9998762
Numerical Solution for Integro-Differential Equations by Using Quartic B-Spline Wavelet and Operational Matrices
Abstract:

In this paper, Semi-orthogonal B-spline scaling functions and wavelets and their dual functions are presented to approximate the solutions of integro-differential equations.The B-spline scaling functions and wavelets, their properties and the operational matrices of derivative for this function are presented to reduce the solution of integro-differential equations to the solution of algebraic equations. Here we compute B-spline scaling functions of degree 4 and their dual, then we will show that by using them we have better approximation results for the solution of integro-differential equations in comparison with less degrees of scaling functions

85
9998760
Optimal Assessment of Faulted Area around an Industrial Customer for Critical Sag Magnitudes
Abstract:

This paper deals with the assessment of faulted area around an industrial customer connected to a particular electric grid that will cause a certain sag magnitude on this customer. The faulted (critical or exposed) area’s length is calculated by adding all line lengths in the neighborhood of the critical node (customer). The applied method is the so-called Method of Critical Distances. By using advanced short-circuit analysis, the Critical Area can be accurately calculated for radial and meshed power networks due to all symmetrical and asymmetrical faults. For the demonstration of the effectiveness of the proposed methodology, a study case is used.

84
9998759
A Research on DC Voltage Offsets Generated by PWM-Controlled Inverters
Abstract:

The increasing penetration of Distributed Generation and storage connected to the distribution network via PWM converters increases the possibility of a DC-component (offset) in voltage or current flowing into the grid. This occurs when even harmonics are present in the network voltage. DC-components can affect the operation and safety of several grid components. Therefore, an investigation of the way they are produced is important in order to take appropriate measures for their elimination. Further research on DC-components that appear on output voltage of converters is performed for different parameters of PWM technique and characteristics of even harmonics.

83
9998758
Technologies of Acylation of Hydroxyanthraquinones
Abstract:

In review the generalized data about different methods of synthesis of biological activity acylatedhydrohyanthraquinones is presented. The basic regularity of a synthesis is analyzed. Action of temperature, pH, solubility, catalysts and other factors on a reaction product yield is revealed.

82
9998757
Bearing Capacity of Sheet Hanger Connection to the Trapezoidal Metal Sheet
Abstract:

Hanging to the trapezoidal sheet by decking hanger is a very widespread solution used in civil engineering to lead the distribution of energy, sanitary, air distribution system etc. under the roof or floor structure. The trapezoidal decking hanger is usually a part of the whole installation system for specific distribution medium. The leading companies offer installation systems for each specific distribution e.g. pipe rings, sprinkler systems, installation channels etc. Every specific part is connected to the base connector which is decking hanger. The own connection has three main components: decking hanger, threaded bar with nuts and web of trapezoidal sheet. The aim of this contribution is determinate the failure mechanism of each component in connection. Load bearing capacity of most components in connection could be calculated by formulas in European codes. This contribution is focused on problematic of bearing resistance of threaded bar in web of trapezoidal sheet. This issue is studied by experimental research and numerical modelling. This contribution presented the initial results of experiment which is compared with numerical model of specimen.

81
9998756
Phasor Analysis of a Synchronous Generator: A Bond Graph Approach
Abstract:

This paper presents the use of phasor bond graphs to obtain the steady-state behavior of a synchronous generator. The phasor bond graph elements are built using 2D multibonds, which represent the real and imaginary part of the phasor. The dynamic bond graph model of a salient-pole synchronous generator is showed, and verified viz. a sudden short-circuit test. The reduction of the dynamic model into a phasor representation is described. The previous test is executed on the phasor bond graph model, and its steady-state values are compared with the dynamic response. Besides, the widely used power (torque)-angle curves are obtained by means of the phasor bond graph model, to test the usefulness of this model.

80
9998755
Analysis of Electrical Networks Using Phasors: A Bond Graph Approach
Abstract:

This paper proposes a phasor representation of electrical networks by using bond graph methodology. A so-called phasor bond graph is built up by means of two-dimensional bonds, which represent the complex plane. Impedances or admittances are used instead of the standard bond graph elements. A procedure to obtain the steady-state values from a phasor bond graph model is presented. Besides the presentation of a phasor bond graph library in SIDOPS code, also an application example is discussed.

79
9998754
Research and Development of Lightweight Repair Mortars with Focus on Their Resistance to High Temperatures
Abstract:

In this article our research focused on study of basic physical and mechanical parameters of polymer-cement repair materials is presented. Namely the influence of applied aggregates in combination with active admixture is specially considered. New formulas which were exposed in ambient with temperature even to 1000°C were suggested. Subsequently densities and strength characteristics including their changes were evaluated. Selected samples were analyzed using electron microscope. The positive influence of porous aggregates based on sintered ash was definitely demonstrated. Further it was found than in terms of thermal resistance the effective micro silica amount represents 5% to 7.5% of cement weight.

78
9998753
The Statistical Significant of Adsorbents for Effective Zn (II) Ions Removal
Abstract:

The adsorption efficiency of various adsorbents for the removal of Zn(II) ions from the waste printing developer was studied in laboratory batch mode. The maximum adsorption efficiency of 94.1% was achieved with unfired clay pellets size (d ≈ 15 mm). The obtained values of adsorption efficiency was subjected to the independent-samples t test in order to investigate the statistically significant differences of the investigated adsorbents for the effective removal of Zn(II) ions from the waste printing developer. The most statistically significant differences of adsorption efficiencies for Zn(II) ions removal were obtained between unfired clay pellets (size d ≈ 15 mm) and activated carbon (½t½=6.909), natural zeolite (½t½=10.380), mixture of activated carbon and natural zeolite (½t½=9.865), bentonite (½t½=6.159), fired clay (½t½=6.641), fired clay pellets (size d ≈ 5 mm) (½t½=6.678), fired clay pellets (size d ≈ 8 mm) (½t½=3.422), respectively.

77
9998752
Antecedents of Word-of-Mouth for Meat with Traceability: Evidence from Thai Consumers
Abstract:

Because of the outbreak of mad cow disease and bird flu, consumers have become more concerned with quality and safety of meat and poultry. As a consequence, meat traceability has been implemented as a tool to raise the standard in the meat production industry. In Thailand, while traceability is relatively common among the manufacturer-wholesaler-retailers cycle, it is rarely used as a marketing tool specifically designed to persuade consumers who are the actual meat endusers. Therefore, the present study attempts to understand what influences consumers to spread their words-of-mouth (WOM) regarding meat with traceability by conducting a study in Thailand where research in this area is rather scant. Data were collected from one hundred and sixty-seven consumers in the northeastern region and analyzed with SEM. The study results reveal that perceived usefulness of traceability system, social norms, and product class knowledge are significant antecedents where consumers spread positive words regarding meat with traceability system. A number of theoretical and managerial implications as well as future study directions are offered at the end of this study report.

76
9998751
A Concept of Rational Water Management at Local Utilities – The Use of RO for Water Supply and Wastewater Treatment/Reuse
Abstract:

Local utilities often face problems of local industrial wastes, storm water disposal due to existing strict regulations. For many local industries, the problem of wastewater treatment and discharge into surface reservoirs can’t be solved through the use of conventional biological treatment techniques. Current discharge standards require very strict removal of a number of impurities such as ammonia, nitrates, phosphate, etc. To reach this level of removal, expensive reagents and sorbents are used. The modern concept of rational water resources management requires the development of new efficient techniques that provide wastewater treatment and reuse. As RO membranes simultaneously reject all dissolved impurities such as BOD, TDS, ammonia, phosphates etc., they become very attractive for the direct treatment of wastewater without biological stage. To treat wastewater, specially designed membrane "open channel" modules are used that do not possess "dead areas" that cause fouling or require pretreatment. A solution to RO concentrate disposal problem is presented that consists of reducing of initial wastewater volume by 100 times. Concentrate is withdrawn from membrane unit as sludge moisture. The efficient use of membrane RO techniques is connected with a salt balance in water system. Thus, to provide high ecological efficiency of developed techniques, all components of water supply and wastewater discharge systems should be accounted for.

75
9998749
Fuzzy Optimization in Metabolic Systems
Abstract:

The optimization of biological systems, which is a branch of metabolic engineering, has generated a lot of industrial and academic interest for a long time. In the last decade, metabolic engineering approaches based on mathematical optimizations have been used extensively for the analysis and manipulation of metabolic networks. In practical optimization of metabolic reaction networks, designers have to manage the nature of uncertainty resulting from qualitative characters of metabolic reactions, e.g., the possibility of enzyme effects. A deterministic approach does not give an adequate representation for metabolic reaction networks with uncertain characters. Fuzzy optimization formulations can be applied to cope with this problem. A fuzzy multi-objective optimization problem can be introduced for finding the optimal engineering interventions on metabolic network systems considering the resilience phenomenon and cell viability constraints. The accuracy of optimization results depends heavily on the development of essential kinetic models of metabolic networks. Kinetic models can quantitatively capture the experimentally observed regulation data of metabolic systems and are often used to find the optimal manipulation of external inputs. To address the issues of optimizing the regulatory structure of metabolic networks, it is necessary to consider qualitative effects, e.g., the resilience phenomena and cell viability constraints. Combining the qualitative and quantitative descriptions for metabolic networks makes it possible to design a viable strain and accurately predict the maximum possible flux rates of desired products. Considering the resilience phenomena in metabolic networks can improve the predictions of gene intervention and maximum synthesis rates in metabolic engineering. Two case studies will present in the conference to illustrate the phenomena.

74
9998747
About the Instability Modes of Current Sheet in Wide Range of Frequencies
Abstract:

We offer a new technique for research of stability of current sheaths in space plasma taking into account the effect of polarization. At the beginning, the found perturbation of the distribution function is used for calculation of the dielectric permeability tensor, which simulates inhomogeneous medium of a current sheath. Further, we in the usual manner solve the system of Maxwell's equations closed with the material equation. The amplitudes of Fourier perturbations are considered to be exponentially decaying through the current sheath thickness. The dispersion equation follows from the nontrivial solution requirement for perturbations of the electromagnetic field. The resulting dispersion equation allows one to study the temporal and spatial characteristics of instability modes of the current sheath (within the limits of the proposed model) over a wide frequency range, including low frequencies.

73
9998746
Application of Sensory Thermography on Workers of a Wireless Industry in Mexico
Abstract:

This study focuses on the application of sensory thermography, as a non-invasive method to evaluate the musculoskeletal injuries that industry workers performing Highly Repetitive Movements (HRM) may acquire. It was made at a wireless company having the target of analyze temperatures in worker’s wrists, elbows and shoulders in workstations during their activities, this thru sensorial thermography with the goal of detecting maximum temperatures (Tmax) that could indicate possible injuries. The tests were applied during 3 hours for only 2 workers that work in workstations where there’s been the highest index of injuries and accidents. We were made comparisons for each part of the body that were study for both because of the similitude between the activities of the workstations; they were requiring both an immediate evaluation. The Tmax was recorder during the test of the worker 2, in the left wrist, reaching a temperature of 35.088ºC and with a maximum increase of 1.856°C

72
9998745
RAPD Analysis of the Genetic Polymorphism in the Collection of Rye Cultivars
Abstract:

In the present study, RAPD-PCR was used to assess genetic diversity of the rye including landrances and new rye cultivars coming from Central Europe and the Union of Soviet Socialist Republics (SUN). Five arbitrary random primers were used to determine RAPD polymorphism in the set of 38 rye genotypes. These primers amplified altogether 43 different DNA fragments with an average number of 8.6 fragments per genotypes. The number of fragments ranged from 7 (RLZ 8, RLZ 9 and RLZ 10) to 12 (RLZ 6). DI and PIC values of all RAPD markers were higher than 0.8 that generally means high level of polymorphism detected between rye genotypes. The dendrogram based on hierarchical cluster analysis using UPGMA algorithm was prepared. The cultivars were grouped into two main clusters. In this experiment, RAPD proved to be a rapid, reliable and practicable method for revealing of polymorphism in the rye cultivars.

71
9998744
Optical Properties of WO3-NiO Complementary Electrochromic Devices
Abstract:

In this study, we developed a complementary electrochromic device consisting of WO3 and NiO films fabricated by rf-magnetron sputtered. The electrochromic properties of WO3 and NiO films were investigated using cyclic voltammograms (CV), performed on WO3 and NiO films immersed in an electrolyte of 1 M LiClO4 in propylene carbonate (PC). Optical and electrochemical of the films, as a function of coloration–bleaching cycle, were characterized using an UV-Vis-NIR spectrophotometer and cyclic voltammetry (CV). After investigating the properties of WO3 film, NiO film, and complementary electrochromic devices, we concluded that this device provides good reversibility, low power consumption of -2.5 V in color state, high variation of transmittance of 58.96%, changes in optical density of 0.81 and good memory effect under open-circuit conditions. In addition, electrochromic component penetration rate can be retained below 20% within 24h, showing preferred memory features; however, component coloring and bleaching response time are about 33s.

70
9998743
Using Printing Method and Post Heat Treatment to Fabricate CIS Absorber Layer
Abstract:

In this study, the Mo-electrode thin films were deposited using two-stepped process and the high purity copper indium selenide-based powder (CuInSe2, CIS) was fabricated by using hydrothermal process by Nanowin Technology Co. Ltd. Because the CIS powder was aggregated into microscale particles, the CIS power was ground into nano-scale particles. 6 wt% CIS particles were mixed and dispersed into isopropyl alcohol (IPA). A new non-vacuum thin-film deposition process, spray coating method (SPM), was investigated to deposit the high-densified CIS absorber layers. 0.1 ml CIS solution was sprayed on the 20 mm×10 mm Mo/glass substrates and then the CuInSe2 thin films were annealed in a selenization furnace using N2 as atmosphere. The annealing temperature and time were set at 550oC and 5 min, and 0.0g~0.6g extra Se content was added in the furnace. The influences of extra Se content on the densification, crystallization, resistivity (ρ), hall mobility (μ), and carrier concentration of the CIS absorber layers were well investigated in this study.

69
9998742
Deposition of Transparent IGZO Conducting Thin Films by Co-Sputtering of Zn2Ga2O3 and In2O3 Targets at Room Temperature
Abstract:

In this study, we investigated (In,Ga,Zn)Ox (IGZO) thin films and examined their characteristics of using Ga2O3-2 ZnO (GZO) co-sputtered In2O3 prepared by dual target radio frequency magnetron sputtering at room temperature in a pure Ar atmosphere. RF powers of 80 W and 70 W were used for GZO and pure In2O3, room temperature (RT) was used as deposition temperature, and the deposition time was changed from 15 min to 60 min. Structural, surface, electrical, and optical properties of IGZO thin films were investigated as a function of deposition time. Furthermore, the GZO co-sputtered In2O3 thin films showed a very smooth and featureless surface and an amorphous structure regardless of the deposition time due to the room temperature sputtering process. We would show that the co-sputtered IGZO thin films exhibited transparent electrode properties with high transmittance ratio and low resistivity.

68
9998741
Service Provider Success: Story of Liberty Autos
Abstract:

The elements for success in the service industry for many organizations have been studied and quantified. They range from effective performance evaluation and management to adequately implementing seven P’s. However, the success story of every organization is unique. What might work for one organization might not for another as every company is inherently distinctive. In this paper, the strategic framework behind the success of Liberty Automobiles Dubai is captured. The primary data necessary for this paper was collected through in-depth interviews with the managers for sales, service and marketing as well as the group general manager. Subsequently, the key areas that led to the success of Liberty Autos will be discussed in this paper.

67
9998740
Optimization of Energy Harvesting Systems for RFID Applications
Abstract:

To avoid battery assisted tags with limited lifetime batteries, it is proposed here to replace them by energy harvesting systems, able to feed from local environment. This would allow total independence to RFID systems, very interesting for applications where tag removal from its location is not possible. Example is here described for luggage safety in airports, and is easily  extendable to similar situation in terms of operation constraints. The idea is to fix RFID tag with energy harvesting system not only to identify luggage but also to supply an embedded microcontroller with a sensor delivering luggage weight making it impossible to add or to remove anything from the luggage during transit phases. The aim is to optimize the harvested energy for such RFID applications, and to study in which limits these applications are theoretically possible. Proposed energy harvester is based on two energy sources: piezoelectricity and electromagnetic waves, so that when the luggage is moving on ground transportation to airline counters, the piezo module supplies the tag and its microcontroller, while the RF module operates during luggage transit thanks to readers located along the way. Tag location on the luggage is analyzed to get best vibrations, as well as harvester better choice for optimizing the energy supply depending on applications and the amount of energy harvested during a period of time. Effects of system parameters (RFID UHF frequencies, limit distance between the tag and the antenna necessary to harvest energy, produced voltage and voltage threshold) are discussed and working conditions for such system are delimited.

66
9998739
Research on Control Strategy of Differential Drive Assisted Steering of Distributed Drive Electric Vehicle
Abstract:

According to the independence, accuracy and controllability of the driving/braking torque of the distributed drive electric vehicle, a control strategy of differential drive assisted steering was designed. Firstly, the assisted curve under different speed and steering wheel torque was developed and the differential torques were distributed to the right and left front wheels. Then the steering return ability assisted control algorithm was designed. At last, the joint simulation was conducted by CarSim/Simulink. The result indicated: the differential drive assisted steering algorithm could provide enough steering drive-assisted under low speed and improve the steering portability. Along with the increase of the speed, the provided steering drive-assisted decreased. With the control algorithm, the steering stiffness of the steering system increased along with the increase of the speed, which ensures the driver’s road feeling. The control algorithm of differential drive assisted steering could avoid the understeer under low speed effectively.

65
9998738
Professional Development of Pre-Service Teachers: The Case of Practicum Experience
Abstract:

The reported study focuses on pre-service teachers’ professional development during the teaching practice. The cohort studied comprised participants in their final year in the Bachelor of Arts and Bachelor of Science with Graduate Certificate in Education programmes of a university in Fiji. Analysis of the data obtained using a survey questionnaire indicates that overall, the pre-service teachers were satisfied with the practicum experience. This is assumed to demonstrate that the practicum experience contributed well towards their professional preparation for work expected of them in Fiji secondary schools. Participants also identified some concerns as needing attention. To conclude, the paper provides suggestions for improving the preparation of teachers by strengthening the identified areas of the practicum offered by the university. The study has implications for other teacher education providers in small developing island states and even beyond for the purpose of enhancing learning in student teachers’ for future work.

64
9998732
Effectiveness of School Strategic Planning: The Case of Fijian Schools
Abstract:

In Fiji, notable among the recent spate of educational reforms has been the Ministry of Education’s (MoEs) requirement that all schools undertake a process of school strategic planning. This preliminary study explores perceptions of a sample of Fijian teachers on the way this exercise has been conducted in their schools. The analysis of both quantitative and qualitative data indicates that school leaders’ lack of knowledge and skills in school strategic planning is a major limitation. As an unsurprising consequence, the process(es) schools adopted did not conform to what the literature suggests as best planning practices. School leaders need more training to ensure they are better prepared to carry out this strategic planning effectively, especially in widening the opportunities for all who have a stake in education to contribute to the process. Implications of the findings are likely to be pertinent to other developing contexts within and beyond the Pacific region for the training of school leaders to ensure they are better equipped to orchestrate and benefit from educational reforms thrust upon them.

63
9998730
Deriving Generic Transformation Matrices for Multi-Axis Milling Machine
Abstract:

This paper proposes a new method to find the equations of transformation matrix for the rotation angles of the two rotational axes and the coordinates of the three linear axes of an orthogonal multi-axis milling machine. This approach provides intuitive physical meanings for rotation angles of multi-axis machines, which can be used to evaluate the accuracy of the conversion from CL data to NC data.

62
9998729
Entropy Generation Analysis of Heat Recovery Vapor Generator for Ammonia-Water Mixture
Abstract:

This paper carries out a performance analysis based on the first and second laws of thermodynamics for heat recovery vapor generator (HRVG) of ammonia-water mixture when the heat source is low-temperature energy in the form of sensible heat. In the analysis, effects of the ammonia mass concentration and mass flow ratio of the binary mixture are investigated on the system performance including the effectiveness of heat transfer, entropy generation, and exergy efficiency. The results show that the ammonia concentration and the mass flow ratio of the mixture have significant effects on the system performance of HRVG.

61
9998728
Systemic Approach to Risk Measurement of Drainage Systems in Urban Areas
Abstract:

The work delineates the threats of maladjustment of the capacity of rain canals, designed and built in the early 20th century, in connection to heavy rainfall, especially in summer. This is the cause of the so called 'urban floods.' It directly relates to fierce raise of paving in the cities. Resolving this problem requires a change in philosophy of draining the rainfall by wider use of retention, infiltration and usage of rainwater.

In systemic approach to managing the safety of urban drainage systems the risk, which is directly connected to safety failures, has been accepted as a measure. The risk level defines the probability of occurrence of losses greater than the ones forecast for a given time frame. The procedure of risk modelling, enabling its numeric analysis by using appropriate weights, is a significant issue in this paper.

60
9998727
Sliding Mode Position Control for Permanent Magnet Synchronous Motors Based On Passivity Approach
Abstract:

In this paper, a sliding mode control method based on the passivity approach is proposed to control the position of surface-mounted permanent magnet synchronous motors (PMSMs). Firstly, the dynamics of a PMSM was proved to be strictly passive. The position controller with an adaptive law was used to estimate the load torque to eliminate the chattering effects associated with the conventional sliding mode controller. The stability analysis of the overall position control system was carried out by adopting the passivity theorem instead of Lyapunov-type arguments. Finally, experimental results were provided to show that the good position tracking can be obtained, and exhibit robustness in the variations of the motor parameters and load torque disturbances.

59
9998726
Model of Community Management for Sustainable Utilization
Abstract:

This research intended to develop the model of community management for sustainable utilization by investigating on 2 groups of population, the family heads and the community management team. The population of the former group consisted of family heads from 511 families in 12 areas to complete the questionnaires which were returned at 479 sets. The latter group consisted of the community management team of 12 areas with 1 representative from each area to give the interview. The questionnaires for the family heads consisted of 2 main parts; general information such as occupations, etc. in the form of checklist. The second part dealt with the data on self reliance community development based on 4P Framework, i.e., People (human resource) development, Place (area) development, Product (economic and income source) development, and Plan (community plan) development in the form of rating scales. Data in the 1st part were calculated to find frequency and percentage while those in the 2nd part were analyzed to find arithmetic mean and SD. Data from the 2nd group of population or the community management team were derived from focus group to find factors influencing successful management together with the in depth interview which were analyzed by descriptive statistics. The results showed that 479 family heads reported that the aspect on the implementation of community plan to self reliance community activities based on Sufficient Economy Philosophy and the 4P was at the average of 3.28 or moderate level. When considering in details, it was found that the 1st aspect was on the area development with the mean of 3.71 or high level followed by human resource development with the mean of 3.44 or moderate level, then, economic and source of income development with the mean of 3.09 or moderate level. The last aspect was community plan development with the mean of 2.89. The results from the small group discussion revealed some factors and guidelines for successful community management as follows: 1) on the People (human resource) development aspect, there was a project to support and develop community leaders. 2) On the aspect of Place (area) development, there was a development on conservative tourism areas. 3) On the aspect of Product (economic and source of income) development, the community leaders promoted the setting of occupational group, saving group, and product processing group. 4) On the aspect of Plan (community plan) development, there was a prioritization through public hearing.

58
9998725
Species Diversity of Migratory Birds along Boat Touring Routes in Klong Kone Sub-District, Muang District, Samut Songkram Province, Thailand
Abstract:

This research aims to study the species, feeding behavior and activity characteristics of birds which reap benefits from the research area in boat touring routes in Klong Kone Sub-district, Muang District, Samut Songkram Province, Thailand from October 2013 – May 2014. The results from the survey of birds on all three routes found that there are 11 families and 22 species. Route 1 (Klong Kone canal) had the most species, 20 species. According to feeding behavior, there were insectivorous, piscivorous and aquatic invertebrate feeder birds. Activity characteristics of birds which reap benefits from the research were finding food, nesting and raise nestlings along boat touring routes.

57
9998724
Bird Diversity along Boat Touring Routes in Tha Ka Sub-District, Amphawa District, Samut Songkram Province, Thailand
Abstract:

This research aims to study species, abundance, status of birds, the similarities and activity characteristics of birds which reap benefits from the research area in boat touring routes in Tha Ka sub-district, Amphawa District, Samut Songkram Province, Thailand. from October 2012 – September 2013. The data was analyzed to find the abundance, and similarity index of the birds. The results from the survey of birds on all three routes found that there are 33 families and 63 species. Route 3 (traditional coconut sugar making kiln – resort) had the most species; 56 species. There were 18 species of commonly found birds with an abundance level of 5, which calculates to 28.57% of all bird species. In August, 46 species are found, being the greatest number of bird species benefiting from this route. As for the status of the birds, there are 51 resident birds, 7 resident and migratory birds, and 5 migratory birds. On Route 2 and Route 3, the similarity index value is equal to 0.881. The birds are classified by their activity characteristics i.e. insectivore, piscivore, granivore, nectrivore and aquatic invertebrate feeder birds. Some birds also use the area for nesting.

56
9998723
The Development of Online Lessons in Integration Model
Abstract:

The objectives of this research were to develop and find the efficiency of integrated online lessons by investigating the usage of online lessons, the relationship between learners’ background knowledge, and the achievement after learning with online lessons. The sample group in this study consisted of 97 students randomly selected from 121 students registering in 1/2012 at Trimitwittayaram Learning Center. The sample technique employed stratified sample technique of 4 groups according to their proficiency, i.e. high, moderate, low, and non-knowledge. The research instrument included online lessons in integration model on the topic of Java Programming, test after each lesson, the achievement test at the end of the course, and the questionnaires to find learners’ satisfaction. The results showed that the efficiency of online lessons was 90.20/89.18 with the achievement of after learning with the lessons higher than that before the lessons at the statistically significant level of 0.05. Moreover, the background knowledge of the learners on the programming showed the positive relationship with the achievement learning at the statistically significant level at 0.05. Learners with high background knowledge employed less exercises and samples than those with lower background knowledge. While learners with different background in the group of moderate and low did not show the significant difference in employing samples and exercises.

55
9998722
Applied Actuator Fault Accommodation in Flight Control Systems Using Fault Reconstruction Based FDD and SMC Reconfiguration
Abstract:

Historically, actuators’ redundancy was used to deal with faults occurring suddenly in flight systems. This technique was generally expensive, time consuming and involves increased weight and space in the system. Therefore, nowadays, the on-line fault diagnosis of actuators and accommodation plays a major role in the design of avionic systems. These approaches, known as Fault Tolerant Flight Control systems (FTFCs) are able to adapt to such sudden faults while keeping avionics systems lighter and less expensive. In this paper, a (FTFC) system based on the Geometric Approach and a Reconfigurable Flight Control (RFC) are presented. The Geometric approach is used for cosmic ray fault reconstruction, while Sliding Mode Control (SMC) based on Lyapunov stability theory is designed for the reconfiguration of the controller in order to compensate the fault effect. Matlab®/Simulink® simulations are performed to illustrate the effectiveness and robustness of the proposed flight control system against actuators’ faulty signal caused by cosmic rays. The results demonstrate the successful real-time implementation of the proposed FTFC system on a non-linear 6 DOF aircraft model.

54
9998721
Analytical Study on Threats to Wetland Ecosystems and their Solutions in the Framework of the Ramsar Convention
Abstract:

Wetlands are one of the most important ecosystems on Earth. Nevertheless, various challenges threaten these ecosystems and disrupt their ecological character. Among these, the effects of human-based threats are more devastating. Following mass degradation of wetlands during 1970s, the Ramsar Convention on Wetlands (Ramsar, Iran, 1971) was concluded to conserve wetlands of international importance and prevent destruction and degradation of such ecosystems through wise use of wetlands as a mean to achieve sustainable development in all over the world. Therefore, in this paper, efforts have been made to analyze threats to wetlands and then investigate solutions in the framework of the Ramsar Convention. Finally, in order to operate these mechanisms, this study concludes that all states should in turn make their best effort to improve and restore global wetlands through preservation of environmental standards and close contribution and also through taking joint measures with other states effectively.

53
9998718
Interval Type-2 Fuzzy Vibration Control of an ERF Embedded Smart Structure
Abstract:

The main objective of this article is to present the semi-active vibration control using an electro-rheological fluid embedded sandwich structure for a cantilever beam. ER fluid is a smart material, which cause the suspended particles polarize and connect each other to form chain. The stiffness and damping coefficients of the ER fluid can be changed in 10 micro seconds; therefore, ERF is suitable to become the material embedded in the tunable vibration absorber to become a smart absorber. For the ERF smart material embedded structure, the fuzzy control law depends on the experimental expert database and the proposed self-tuning strategy. The electric field is controlled by a CRIO embedded system to implement the real application. This study investigates the different performances using the Type-1 fuzzy and interval Type-2 fuzzy controllers. The Interval type-2 fuzzy control is used to improve the modeling uncertainties for this ERF embedded shock absorber. The self-tuning vibration controllers using Type-1 and Interval Type-2 fuzzy law are implemented to the shock absorber system. Based on the resulting performance, Internal Type-2 fuzzy is better than the traditional Type-1 fuzzy control for this vibration control system.

 

52
9998716
Formation of Round Channel for Microfluidic Applications
Abstract:

PDMS (Polydimethylsiloxane) polymer is a suitable material for biological and MEMS (Microelectromechanical systems) designers, because of its biocompatibility, transparency and high resistance under plasma treatment. PDMS round channel is always been of great interest due to its ability to confine the liquid with membrane type micro valves. In this paper we are presenting a very simple way to form round shapemicrofluidic channel, which is based on reflow of positive photoresist AZ® 40 XT. With this method, it is possible to obtain channel of different height simply by varying the spin coating parameters of photoresist.

51
9998715
Generalized Mean-field Theory of Phase Unwrapping via Multiple Interferograms
Authors:
Abstract:

On the basis of Bayesian inference using the maximizer of the posterior marginal estimate, we carry out phase unwrapping using multiple interferograms via generalized mean-field theory. Numerical calculations for a typical wave-front in remote sensing using the synthetic aperture radar interferometry, phase diagram in hyper-parameter space clarifies that the present method succeeds in phase unwrapping perfectly under the constraint of surface- consistency condition, if the interferograms are not corrupted by any noises. Also, we find that prior is useful for extending a phase in which phase unwrapping under the constraint of the surface-consistency condition. These results are quantitatively confirmed by the Monte Carlo simulation.

50
9998714
Analytical Solutions for Geodesic Acoustic Eigenmodes in Tokamak Plasmas
Abstract:

The analytical solutions for geodesic acoustic eigenmodes in tokamak plasmas with circular concentric magnetic surfaces are found. In the frame of ideal magnetohydrodynamics the dispersion relation taking into account the toroidal coupling between electrostatic perturbations and electromagnetic perturbations with poloidal mode number |m| = 2 is derived. In the absence of such a coupling the dispersion relation gives the standard continuous spectrum of geodesic acoustic modes. The analysis of the existence of global eigenmodes for plasma equilibria with both off-axis and on-axis maximum of the local geodesic acoustic frequency is performed.

49
9998713
2D-Modeling with Lego Mindstorms
Abstract:

The whole work is based on possibility to use Lego Mindstorms robotics systems to reduce costs. Lego Mindstorms consists of a wide variety of hardware components necessary to simulate, programme and test of robotics systems in practice. To programme algorithm, which simulates space using the ultrasonic sensor, was used development environment supplied with kit. Software Matlab was used to render values afterwards they were measured by ultrasonic sensor. The algorithm created for this paper uses theoretical knowledge from area of signal processing. Data being processed by algorithm are collected by ultrasonic sensor that scans 2D space in front of it. Ultrasonic sensor is placed on moving arm of robot which provides horizontal moving of sensor. Vertical movement of sensor is provided by wheel drive. The robot follows map in order to get correct positioning of measured data. Based on discovered facts it is possible to consider Lego Mindstorm for low-cost and capable kit for real-time modelling.

48
9998708
Design of a Low Cost Motion Data Acquisition Setup for Mechatronic Systems
Abstract:

Motion sensors have been commonly used as a valuable component in mechatronic systems, however, many mechatronic designs and applications that need motion sensors cost enormous amount of money, especially high-tech systems. Design of a software for communication protocol between data acquisition card and motion sensor is another issue that has to be solved. This study presents how to design a low cost motion data acquisition setup consisting of MPU 6050 motion sensor (gyro and accelerometer in 3 axes) and Arduino Mega2560 microcontroller. Design parameters are calibration of the sensor, identification and communication between sensor and data acquisition card, interpretation of data collected by the sensor.

47
9998705
Polymorphism of HMW-GS in Collection of Wheat Genotypes
Abstract:

Processes of plant breeding, testing and licensing of new varieties, patent protection in seed production, relations in trade and protection of copyright are dependent on identification, differentiation and characterization of plant genotypes. Therefore, we focused our research on utilization of wheat storage proteins as genetic markers suitable not only for differentiation of individual genotypes, but also for identification and characterization of their considerable properties. We analyzed a collection of 102 genotypes of bread wheat (Triticum aestivum L.), 41 genotypes of spelt wheat (Triticum spelta L.), and 35 genotypes of durum wheat (Triticum durum Desf.), in this study. Our results show, that genotypes of bread wheat and durum wheat were homogenous and single line, but spelt wheat genotypes were heterogenous. We observed variability of HMW-GS composition according to environmental factors and level of breeding and predict technological quality on the basis of Glu-score calculation.

46
9998704
RAPD Analysis of Genetic Diversity of Castor Bean
Abstract:

The aim of this work was to detect genetic variability among the set of 40 castor genotypes using 8 RAPD markers. Amplification of genomic DNA of 40 genotypes, using RAPD analysis, yielded in 66 fragments, with an average of 8.25 polymorphic fragments per primer. Number of amplified fragments ranged from 3 to 13, with the size of amplicons ranging from 100 to 1200 bp. Values of the polymorphic information content (PIC) value ranged from 0.556 to 0.895 with an average of 0.784 and diversity index (DI) value ranged from 0.621 to 0.896 with an average of 0.798. The dendrogram based on hierarchical cluster analysis using UPGMA algorithm was prepared and analyzed genotypes were grouped into two main clusters and only two genotypes could not be distinguished. Knowledge on the genetic diversity of castor can be used for future breeding programs for increased oil production for industrial uses.

45
9998703
Learning Based On Computer Science Unplugged in Computer Science Education: Design, Development, and Assessment
Abstract:

Although, all high school students in Japan are required to learn informatics, many of them do not learn this topic sufficiently. In response to this situation, we propose a support package for high school informatics classes. To examine what students learned and if they sufficiently understood the context of the lessons, a questionnaire survey was distributed to 186 students. We analyzed the results of the questionnaire and determined the weakest units, which were “basic computer configuration” and “memory and secondary storage”. We then developed a package for teaching these units. We propose that our package be applied in high school classrooms.

44
9998701
Reducing Greenhouse Gas Emissions by Recyclable Material Bank Project of Universities in Central Region of Thailand
Abstract:

This research studied recycled waste by the Recyclable Material Bank Project of 4 universities in the central region of Thailand for the evaluation of reducing greenhouse gas emissions compared with landfilling activity during July 2012 to June 2013. The results showed that the projects collected total amount of recyclable wastes of about 911,984.80 kilograms. Office paper had the largest amount among these recycled wastes (50.68% of total recycled waste). Groups of recycled waste can be prioritized from high to low according to their amount as paper, plastic, glass, mixed recyclables, and metal, respectively. The project reduced greenhouse gas emissions equivalent to about 2814.969 metric tons of carbon dioxide. The most significant recycled waste that affects the reduction of greenhouse gas emissions is office paper which is 70.16% of total reduced greenhouse gasses emission. According to amount of reduced greenhouse gasses emission, groups of recycled waste can be prioritized from high to low significances as paper, plastic, metals, mixed recyclables, and glass, respectively.

43
9998700
Optimal Design for SARMA(P,Q)L Process of EWMA Control Chart
Authors:
Abstract:

The main goal of this paper is to study Statistical Process Control (SPC) with Exponentially Weighted Moving Average (EWMA) control chart when observations are serially-correlated. The characteristic of control chart is Average Run Length (ARL) which is the average number of samples taken before an action signal is given. Ideally, an acceptable ARL of in-control process should be enough large, so-called (ARL0). Otherwise it should be small when the process is out-of-control, so-called Average of Delay Time (ARL1) or a mean of true alarm. We find explicit formulas of ARL for EWMA control chart for Seasonal Autoregressive and Moving Average processes (SARMA) with Exponential white noise. The results of ARL obtained from explicit formula and Integral equation are in good agreement. In particular, this formulas for evaluating (ARL0) and (ARL1) be able to get a set of optimal parameters which depend on smoothing parameter (λ) and width of control limit (H) for designing EWMA chart with minimum of (ARL1).

42
9998699
Fears of Strangers: Causes of Anonymity Rejection on Virtual World
Abstract:

This research is a collaborative narrative research, which is mixed with issues of selected papers and researcher's experience as an anonymous user on social networking sites. The objective of this research is to understand the reasons of the regular users who reject to contact with anonymous users, and to study the communication traditions used in the selected studies. Anonymous users are rejected by regular users, because of the fear of cyber bully, the fear of unpleasant behaviors, and unwillingness of changing communication norm. The suggestion for future research design is to use longitudinal design or quantitative design; and the theory in rhetorical tradition should be able to help develop a strong trust message.

41
9998698
Fingerprint on Ballistic after Shooting
Abstract:

This research involved fingerprints on ballistics after shooting. Two objectives of research were as follow; (1) to study the duration of the existence of latent fingerprints on .38, .45, 9 mm and .223 cartridge case after shooting, and (2) to compare the effectiveness of the detection of latent fingerprints by Black Powder, Super Glue, Perma Blue and Gun Bluing. The latent fingerprint appearance were studied on .38, .45, 9 mm. and .223 cartridge cases before and after shooting with Black Powder, Super Glue, Perma Blue and Gun Bluing. The detection times were 3 minute, 6, 12, 18, 24, 30, 36, 42, 48, 54, 60, 66, 72, 78 and 84 hours respectively. As a result of the study, it can be conclude that

Before shooting, the detection of latent fingerprints on 38, .45, and 9 mm. and .223 cartridge cases with Black Powder, Super Glue, Perma Blue and Gun Bluing can detect the fingerprints at all detection times. After shooting, the detection of latent fingerprints on .38, .45, 9 mm. and .223 cartridge cases with Black Powder, Super Glue did not appear. The detection of latent fingerprints on .38, .45, 9 mm. cartridge cases with Perma Blue and Gun Bluing were found 100% of the time and the detection of latent fingerprints on .223 cartridge cases with Perma Blue and Gun Bluing were found 40% and 46.67% of the time, respectively.
40
9998697
Integrated Evaluation of Green Design and Green Manufacturing Processes Using a Mathematical Model
Abstract:

In this research, a mathematical model for integrated evaluation of green design and green manufacturing processes is presented. To design a product, there can be alternative options to design the detailed components to fulfill the same product requirement. In the design alternative cases, the components of the product can be designed with different materials and detailed specifications. If several design alternative cases are proposed, the different materials and specifications can affect the manufacturing processes. In this paper, a new concept for integrating green design and green manufacturing processes is presented. A green design can be determined based the manufacturing processes of the designed product by evaluating the green criteria including energy usage and environmental impact, in addition to the traditional criteria of manufacturing cost. With this concept, a mathematical model is developed to find the green design and the associated green manufacturing processes. In the mathematical model, the cost items include material cost, manufacturing cost, and green related cost. The green related cost items include energy cost and environmental cost. The objective is to find the decisions of green design and green manufacturing processes to achieve the minimized total cost. In practical applications, the decision-making can be made to select a good green design case and its green manufacturing processes. In this presentation, an example product is illustrated. It shows that the model is practical and useful for integrated evaluation of green design and green manufacturing processes.

39
9998696
First Order Filter Based Current-Mode Sinusoidal Oscillators Using Current Differencing Transconductance Amplifiers (CDTAs)
Abstract:

This article presents new current-mode oscillator circuits using CDTAs which is designed from block diagram. The proposed circuits consist of two CDTAs and two grounded capacitors. The condition of oscillation and the frequency of oscillation can be adjusted by electronic method. The circuits have high output impedance and use only grounded capacitors without any external resistor which is very appropriate to future development into an integrated circuit. The results of PSPICE simulation program are corresponding to the theoretical analysis.

38
9998695
Design of Regular Communication Area for Infrared Electronic-Toll-Collection Systems
Abstract:

A design of communication area for infrared electronic-toll-collection systems to provide an extended communication interval in the vehicle traveling direction and regular boundary between contiguous traffic lanes is proposed. By utilizing two typical low-cost commercial infrared LEDs with different half-intensity angles Φ1/2 = 22◦ and 10◦, the radiation pattern of the emitter is designed to properly adjust the spatial distribution of the signal power. The aforementioned purpose can be achieved with an LED array in a three-piece structure with appropriate mounting angles. With this emitter, the influence of the mounting parameters, including the mounting height and mounting angles of the on-board unit and road-side unit, on the system performance in terms of the received signal strength and communication area are investigated. The results reveal that, for our emitter proposed in this paper, the ideal ”long-and-narrow” characteristic of the communication area is very little affected by these mounting parameters. An optimum mounting configuration is also suggested.

37
9998694
Characterization of Biodegradable Polycaprolactone Containing Titanium Dioxide Micro and Nanoparticles
Abstract:

Composites based on a biodegradable polycaprolactone (PCL) containing 0.5, 1.0 and 2.0 wt % of titanium dioxide (TiO2) micro and nanoparticles were prepared by melt mixing and the effect of filler type and contents on the thermal properties, dynamic-mechanical behaviour and morphology were investigated. Measurements of storage modulus and loss modulus by dynamic mechanical analysis (DMA) showed better results for microfilled PCL/TiO2 composites than nanofilled composites, with the same filler content. DSC analysis showed that the Tg and Tc of micro and nanocomposites were slightly lower than those of neat PCL. The crystallinity of the PCL increased with the addition of TiO2 micro and nanoparticles; however, the cc for the PCL was unchanged with micro TiO2 content. The thermal stability of PCL/TiO2 composites were characterized using thermogravimetric analysis (TGA). The initial weight loss (5 wt %) occurs at slightly higher temperature with micro and nano TiO2 addition and with increasing TiO2 content.

36
9998693
Material Failure Process Simulation by Improve Finite Elements with Embedded Discontinuities
Abstract:

This paper shows the advantages of the material failure process simulation by improve finite elements with embedded discontinuities, using a new definition of traction vector, dependent on the discontinuity length and the angle. Particularly, two families of this kind of elements are compared: kinematically optimal symmetric and statically and kinematically optimal non-symmetric. The constitutive model to describe the behavior of the material in the symmetric formulation is a traction-displacement jump relationship equipped with softening after reaching the failure surface.

To show the validity of this symmetric formulation, representative numerical examples illustrating the performance of the proposed formulation are presented. It is shown that the non-symmetric family may over or underestimate the energy required to create a discontinuity, as this effect is related with the total length of the discontinuity, fact that is not noticed when the discontinuity path is a straight line.

35
9998692
On the Seismic Response of Collided Structures
Abstract:

This study examines the inelastic behavior of adjacent planar reinforced concrete (R.C.) frames subjected to strong ground motions. The investigation focuses on the effects of vertical ground motion on the seismic pounding. The examined structures are modeled and analyzed by RUAUMOKO dynamic nonlinear analysis program using reliable hysteretic models for both structural members and contact elements. It is found that the vertical ground motion mildly affects the seismic response of adjacent buildings subjected to structural pounding and, for this reason, it can be ignored from the displacement and interstorey drifts assessment. However, the structural damage is moderately affected by the vertical component of earthquakes.

34
9998691
Corporate Environmentalism: A Case Study in the Czech Republic
Authors:
Abstract:

This study examines perception of environmental approach in small and medium-sized enterprises (SMEs) – the process by which firms integrate environmental concern into business. Based on a review of the literature, the paper synthesizes focus on environmental issues with the reflection in a case study in the Czech Republic. Two themes of corporate environmentalism are discussed – corporate environmental orientation and corporate stances toward environmental concerns. It provides theoretical material on greening organizational culture that is helpful in understanding the response of contemporary business to environmental problems. We integrate theoretical predictions with empirical findings confronted with reality. Scales to measure these themes are tested in a survey of managers in 229 Czech firms. We used the process of in-depth questioning. The research question was derived and answered in the context of the corresponding literature and conducted research. A case study showed us that environmental approach is variety different (depending on the size of the firm) in SMEs sector. The results of the empirical mapping demonstrate Czech company’s approach to environment and define the problem areas and pinpoint the main limitation in the expansion of environmental aspects. We contribute to the debate for recognition of the particular role of environmental issues in business reality.

33
9998690
Measurement of Innovation Performance
Abstract:

Time full of changes which is associated with globalization, tougher competition, changes in the structures of markets and economic downturn, that all force companies to think about their competitive advantages. These changes can bring the company a competitive advantage and that can help improve competitive position in the market. Policy of the European Union is focused on the fast growing innovative companies which quickly respond to market demands and consequently increase its competitiveness. To meet those objectives companies need the right conditions and support of their state.

32
9998689
Failure to Replicate the Unconscious Thought Advantages
Abstract:

In this study we tried to replicate the unconscious thought advantage (UTA), which states that complex decisions are better handled by unconscious thinking. We designed an experiment in e-prime using similar material as the original study (choosing between four different apartments, each described by 12 attributes). A total of 73 participants (52 women (71.2%); 18 to 62 age: M=24.63; SD=8.7) took part in the experiment. We did not replicate the results suggested by UTT. However, from the present study we cannot conclude whether this was the case of flaws in the theory or flaws in our experiment and we discuss several ways in which the issue of UTA could be examined further.

31
9998688
Future Housing Energy Efficiency Associated with the Auckland Unitary Plan
Authors:
Abstract:

The draft Auckland Unitary Plan outlines the future land used for new housing and businesses with Auckland population growth over the next thirty years. According to Auckland Unitary Plan, over the next 30 years, the population of Auckland is projected to increase by one million, and up to 70% of total new dwellings occur within the existing urban area. Intensification will not only increase the number of median or higher density houses such as terrace house, apartment building, etc. within the existing urban area but also change mean housing design data that can impact building thermal performance under the local climate. Based on mean energy consumption and building design data, and their relationships of a number of Auckland sample houses, this study is to estimate the future mean housing energy consumption associated with the change of mean housing design data and evaluate housing energy efficiency with the Auckland Unitary Plan.

30
9998687
Development of a New Piezoelectrically Actuated Micropump for Liquid and Gas
Abstract:

This paper aims to present the design, fabrication and test of a novel piezoelectric actuated, check-valves embedded micropump having the advantages of miniature size, light weight and low power consumption. This device is designed to pump gases and liquids with the capability of performing the self-priming and bubble-tolerant work mode by maximizing the stroke volume of the membrane as well as the compression ratio via minimization of the dead volume of the micropump chamber and channel. By experiment apparatus setup, we can get the real-time values of the flow rate of micropump, the displacement of the piezoelectric actuator and the deformation of the check valve, simultaneously. The micropump with check valve 0.4 mm in thickness obtained higher output performance under the sinusoidal waveform of 120 Vpp. The micropump achieved the maximum pumping rates of 42.2 ml/min and back pressure of 14.0 kPa at the corresponding frequency of 28 and 20 Hz. The presented micropump is able to pump gases with a pumping rate of 196 ml/min at operating frequencies of 280 Hz under the sinusoidal waveform of 120 Vpp.

29
9998686
Resistive Switching in TaN/AlNx/TiN Cell
Abstract:

Resistive switching of aluminum nitride (AlNx) thin film was demonstrated in a TaN/AlNx/TiN memory cell that was prepared by sputter deposition techniques. The memory cell showed bipolar switching of resistance between +3.5 V and –3.5 V. The resistance ratio of high resistance state (HRS) to low resistance state (HRS), RHRS/RLRS, was about 2 over 100 cycles of endurance test. Both the LRS and HRS of the memory cell exhibited ohmic conduction at low voltages and Poole-Frenkel emission at high voltages. The electrical conduction in the TaN/AlNx/TiN memory cell was possibly attributed to the interactions between charges and defects in the AlNx film.

28
9998685
Issues in Travel Demand Forecasting
Authors:
Abstract:

Travel demand forecasting including four travel choices, i.e., trip generation, trip distribution, modal split and traffic assignment constructs the core of transportation planning. In its current application, travel demand forecasting has associated with three important issues, i.e., interface inconsistencies among four travel choices, inefficiency of commonly used solution algorithms, and undesirable multiple path solutions. In this paper, each of the three issues is extensively elaborated. An ideal unified framework for the combined model consisting of the four travel choices and variable demand functions is also suggested. Then, a few remarks are provided in the end of the paper

27
9998684
A Panel Cointegration Analysis for Macroeconomic Determinants of International Housing Market
Abstract:

The main purpose of this paper is to investigate thelong-run equilibrium and short-run dynamics of international housing prices when macroeconomic variables change. We apply the Pedroni’s, panel cointegration, using the unbalanced panel data analysis of 33 countries over the period from 1980Q1 to 2013Q1, to examine the relationships among house prices and macroeconomic variables. Our empirical results of panel data cointegration tests support the existence of a cointegration among these macroeconomic variables and house prices. Besides, the empirical results of panel DOLS further present that a 1% increase in economic activity, long-term interest rates, and construction costs cause house prices to respectively change 2.16%, -0.04%, and 0.22% in the long run.Furthermore, the increasing economic activity and the construction cost would cause strongerimpacts on the house prices for lower income countries than higher income countries.The results lead to the conclusion that policy of house prices growth can be regarded as economic growth for lower income countries. Finally, in America region, the coefficient of economic activity is the highest, which displays that increasing economic activity causes a faster rise in house prices there than in other regions. There are some special cases whereby the coefficients of interest rates are significantly positive in America and Asia regions.

26
9998683
A New Concept for Deriving the Expected Value of Fuzzy Random Variables
Abstract:

Fuzzy random variables have been introduced as an imprecise concept of numeric values for characterizing the imprecise knowledge. The descriptive parameters can be used to describe the primary features of a set of fuzzy random observations. In fuzzy environments, the expected values are usually represented as fuzzy-valued, interval-valued or numeric-valued descriptive parameters using various metrics. Instead of the concept of area metric that is usually adopted in the relevant studies, the numeric expected value is proposed by the concept of distance metric in this study based on two characters (fuzziness and randomness) of FRVs. Comparing with the existing measures, although the results show that the proposed numeric expected value is same with those using the different metric, if only triangular membership functions are used. However, the proposed approach has the advantages of intuitiveness and computational efficiency, when the membership functions are not triangular types. An example with three datasets is provided for verifying the proposed approach.

25
9998682
CFD Simulations to Examine Natural Ventilation of a Work Area in a Public Building
Abstract:

Natural ventilation has played an important role for many low energy-building designs. It has been also noticed as a essential subject to persistently bring the fresh cool air from the outside into a building. This study carried out the computational fluid dynamics (CFD)-based simulations to examine the natural ventilation development of a work area in a public building. The simulated results can be useful to better understand the indoor microclimate and the interaction of wind with buildings. Besides, this CFD simulation procedure can serve as an effective analysis tool to characterize the airing performance, and thereby optimize the building ventilation for strengthening the architects, planners and other decision makers on improving the natural ventilation design of public buildings.

24
9998681
An AK-Chart for the Non-Normal Data
Abstract:

Traditional multivariate control charts assume that measurement from manufacturing processes follows a multivariate normal distribution. However, this assumption may not hold or may be difficult to verify because not all the measurement from manufacturing processes are normal distributed in practice. This study develops a new multivariate control chart for monitoring the processes with non-normal data. We propose a mechanism based on integrating the one-class classification method and the adaptive technique. The adaptive technique is used to improve the sensitivity to small shift on one-class classification in statistical process control. In addition, this design provides an easy way to allocate the value of type I error so it is easier to be implemented. Finally, the simulation study and the real data from industry are used to demonstrate the effectiveness of the propose control charts.

23
9998680
PTFE Capillary-Based DNA Amplification within an Oscillatory Thermal Cycling Device
Abstract:

This study describes a capillary-based device integrated with the heating and cooling modules for polymerase chain reaction (PCR). The device consists of the reaction polytetrafluoroethylene (PTFE) capillary, the aluminum blocks, and is equipped with two cartridge heaters, a thermoelectric (TE) cooler, a fan, and some thermocouples for temperature control. The cartridge heaters are placed into the heating blocks and maintained at two different temperatures to achieve the denaturation and the extension step. Some thermocouples inserted into the capillary are used to obtain the transient temperature profiles of the reaction sample during thermal cycles. A 483-bp DNA template is amplified successfully in the designed system and the traditional thermal cycler. This work should be interesting to persons involved in the high-temperature based reactions and genomics or cell analysis.

22
9998679
Longitudinal Vortices Mixing in Three-Stream Micromixers with Two Inlets
Abstract:

In this work, we examine fluid mixing in a full three-stream mixing channel with longitudinal vortex generators (LVGs) built on the channel bottom by numerical simulation and experiment. The effects of the asymmetrical arrangement and the attack angle of the LVGs on fluid mixing are investigated. The results show that the micromixer with LVGs at a small asymmetry index (defined by the ratio of the distance from the center plane of the gap between the winglets to the center plane of the main channel to the width of the main channel) is superior to the micromixer with symmetric LVGs and that with LVGs at a large asymmetry index. The micromixer using five mixing modules of the LVGs with an attack angle between 16.5 degrees and 22.5 degrees can achieve excellent mixing over a wide range of Reynolds numbers. Here, we call a section of channel with two pairs of staggered asymmetrical LVGs a mixing module. Besides, the micromixer with LVGs at a small attack angle is more efficient than that with a larger attack angle when pressure losses are taken into account.

21
9998676
Studies on Race Car Aerodynamics at Wing in Ground Effect
Abstract:

Numerical studies on race car aerodynamics at wing in ground effect have been carried out using a steady 3d, double precision, pressure-based, and standard k-epsilon turbulence model. Through various parametric analytical studies we have observed that at a particular speed and ground clearance of the wings a favorable negative lift was found high at a particular angle of attack for all the physical models considered in this paper. The fact is that if the ground clearance height to chord length (h/c) is too small, the developing boundary layers from either side (the ground and the lower surface of the wing) can interact, leading to an altered variation of the aerodynamic characteristics at wing in ground effect. Therefore a suitable ground clearance must be predicted throughout the racing for a better performance of the race car, which obviously depends upon the coupled effects of the topography, wing orientation with respect to the ground, the incoming flow features and/or the race car speed. We have concluded that for the design of high performance and high speed race cars the adjustable wings capable to alter the ground clearance and the angles of attack is the best design option for any race car for racing safely with variable speeds.

20
9998675
Successful Management of a Boy with Mild Persistent Asthma (A Longitudinal Case)
Abstract:

Asthma is a condition that causing chronic health problems in children. In addition to basic therapy against disease, we must try to reduce the impact of chronic health problems and also optimize their medical aspect of growth and development. A boy with mild asthma attack frequent episode did not showed any improvement with medical treatment and his asthma control test was 11. From radiologic examination he got hyperaerated lung and billateral sinusitis maxillaris; skin test results were house dust, food and pet allergy; an overweight body; bad school grades; psychological and environmental problem. We followed and evaluated this boy in 6 months, treated holistically. Even we could not do much on environmental but no more psychological and school problems, his on a good bodyweight and his asthma control test was 22. A case of a child with mild asthma attack frequent episode was reported. Asthma clinical course show no significant improvement when other predisposing factor is not well-controlled and a child’s growth and development may be affected. Improving condition of the patient can be created with the help of loving and caring way of nurturing from the parents and supportive peer group. Therefore, continuous and consistent monitoring is required because prognosis of asthma is generally good when regularly and properly controlled.

19
9998673
Mobile Phone Banking Applies and Customer Intention - A Case Study in Libya
Abstract:

Aim of this paper is to explore the prospect of a new approach of mobile phone banking in Libya. This study evaluates customer knowledge on commercial mobile banking in Libya. To examine the relationship between age, occupation and intention for using mobile banking for commercial purpose, a survey was conducted to gather information from one hundred Libyan bank clients. The results indicate that Libyan customers have accepted the new technology and they are ready to use it. There is no significant joint relationship between age and occupation found in intention to use mobile banking in Libya. On the other hand, the customers’ knowledge about mobile banking has a greater relationship with the intention. This study has implications for demographic researches and consumer behaviour disciplines. It also has profitable implications for banks and managers in Libya, as it will assist in better understanding of the Libyan consumers and their activities, when they develop their market strategies and new service.

 

18
9998666
A Dual Band Microstrip Patch Antenna for WLAN and WiMAX Applications
Authors:
Abstract:

In this paper, the design of a multiple U-slotted microstrip patch antenna with frequency selective surface (FSS) as a superstrate for WLAN and WiMAX applications is presented. The proposed antenna is designed by using substrate FR4 having permittivity of 4.4 and air substrate. The characteristics of the antenna are designed and evaluated the performance of modelled antenna using CST Microwave studio. The proposed antenna dual resonant frequency has been achieved in the band of 2.37-2.55 GHz and 3.4-3.6 GHz. Because of the impact of FSS superstrate, it is found that the bandwidths have been improved from 6.12% to 7.35 % and 3.7% to 5.7% at resonant frequencies 2.45 GHz and 3.5 GHz, respectively. The maximum gain at the resonant frequency of 2.45 and 3.5 GHz are 9.3 and 11.33 dBi, respectively.

17
9998665
A Longitudinal Study of the Readability of the Chairman’s Narratives in Corporate Reports: Malaysian Evidence
Abstract:

This paper examines the readability of the chairman’s narratives, as determined by the Flesch score, of a Malaysian public listed company’s corporate reports from 1962 to 2009. It partially supports earlier studies which demonstrated that corporate reports were difficult to read, and had shown very negligible decrease in difficulty over time. Net profit to sales and readability was significantly positively correlated but number of financial statements was significantly negatively correlated with readability.

16
9998659
Analysis of SCR-Based ESD Protection Circuit on Holding Voltage Characteristics
Abstract:

This paper presents a silicon controller rectifier (SCR) based ESD protection circuit for IC. The proposed ESD protection circuit has low trigger voltage and high holding voltage compared with conventional SCR ESD protection circuit. Electrical characteristics of the proposed ESD protection circuit are simulated and analyzed using TCAD simulator. The proposed ESD protection circuit verified effective low voltage ESD characteristics with low trigger voltage and high holding voltage.

15
9998658
Multiple Organ Manifestation in Neonatal Lupus Erythematous (Report of Two Cases)
Abstract:

Neonatal lupus erythematous (NLE) is a rare disease marked by clinical characteristic and specific maternal autoantibody. Many cutaneous, cardiac, liver, and hematological manifestations could happen with affect of one organ or multiple. In this case, both babies were premature, low birth weight (LBW), small for gestational age (SGA) and born through caesarean section from a systemic lupus erythematous (SLE) mother. In the first case, we found a baby girl with dyspnea and grunting. Chest X ray showed respiratory distress syndrome (RDS) great I and echocardiography showed small atrial septal defect (ASD) and ventricular septal defect (VSD). She also developed anemia, thrombocytopenia, elevated C-reactive protein, hypoalbuminemia, increasing coagulation factors, hyperbilirubinemia, and positive blood culture of Klebsiella pneumonia. Anti-Ro/SSA and Anti-nRNP/sm were positive. Intravenous fluid, antibiotic, transfusion of blood, thrombocyte concentrate, and fresh frozen plasma were given. The second baby, male presented with necrotic tissue on the left ear and skin rashes, erythematous macula, athropic scarring, hyperpigmentation on all of his body with various size and facial haemorrhage. He also suffered from thrombocytopenia, mild elevated transaminase enzyme, hyperbilirubinemia, anti-Ro/SSA was positive. Intravenous fluid, methyprednisolone, intravenous immunoglobulin (IVIG), blood, and thrombocyte concentrate transfution were given. Two cases of neonatal lupus erythematous had been presented. Diagnosis based on clinical presentation and maternal auto antibody on neonate. Organ involvement in NLE can occur as single or multiple manifestations.

14
9998657
Comparison on Electrode and Ground Arrangements Effect on Heat Transfer under Electric Force in a Channel and a Cavity Flow
Abstract:

This study numerically investigates the effects of Electrohydrodynamic on flow patterns and heat transfer enhancement within a cavity which is on the lower wall of channel. In this simulation, effects of using ground wire and ground plate on the flow patterns are compared. Moreover, the positions of electrode wire respecting with ground are tested in the range of angles θ = 0 - 180o. High electrical voltage exposes to air is 20 kV. Bulk mean velocity and temperature of inlet air are controlled at 0.1 m/s and 60 OC, respectively. The result shows when electric field is applied, swirling flow is appeared in the channel. In addition, swirling flow patterns in the main flow of using ground plate are widely spreader than that of using ground wire. Moreover, direction of swirling flow also affects the flow pattern and heat transfer in a cavity. These cause the using ground wire to give the maximum temperature and heat transfer higher than using ground plate. Furthermore, when the angle is at θ = 60o, high shear flow effect is obtained. This results show high strength of swirling flow and effective heat transfer enhancement.

13
9998651
A Parametric Study on Lateral Torsional Buckling of European IPN and IPE Cantilevers
Authors:
Abstract:

IPN and IPE sections, which are commonly used European I shapes, are widely used in steel structures as cantilever beams to support overhangs. A considerable number of studies exist on calculating lateral torsional buckling load of I sections. However, most of them provide series solutions or complex closed-form equations. In this paper, a simple equation is presented to calculate lateral torsional buckling load of IPN and IPE section cantilever beams. First, differential equation of lateral torsional buckling is solved numerically for various loading cases. Then a parametric study is conducted on results to present an equation for lateral torsional buckling load of European IPN and IPE beams. Finally, results obtained by presented equation are compared to differential equation solutions and finite element model results. ABAQUS software is utilized to generate finite element models of beams. It is seen that the results obtained from presented equation coincide with differential equation solutions and ABAQUS software results. It can be suggested that presented formula can be safely used to calculate critical lateral torsional buckling load of European IPN and IPE section cantilevers.

12
9998640
High Gain Mobile Base Station Antenna Using Curved Woodpile EBG Technique
Abstract:

This paper presents the gain improvement of a sector antenna for mobile phone base station by using the new technique to enhance its gain for microstrip antenna (MSA) array without construction enlargement. The curved woodpile Electromagnetic Band Gap (EBG) has been utilized to improve the gain instead. The advantages of this proposed antenna are reducing the length of MSAs array but providing the higher gain and easy fabrication and installation. Moreov